All animal procedures were conducted in accordance with the guidelines for the Use and Care of Laboratory Animals and approved by the West Virginia University Institutional Animal Care and Use Committee (WVU IACUC).

Human lung epithelial BEAS-2B, human non-small (large) cell lung cancer H460 cells derived from patient pleural effusion, and human umbilical vein endothelial cells (HUVEC) were obtained from American Type Culture Collection (ATCC; Manassas, VA). BEAS-2B cells were cultured in DMEM medium containing 5% fetal bovine serum (FBS), 2 mM L-glutamine, 100 units/ml penicillin/streptomycin. H460 cells were cultured in RPMI 1640 medium containing 10% FBS. HUVEC cells were cultured in F12K medium supplemented with 10% FBS, 0.1 mg/ml heparin sulfate, 0.05 mg/ml endothelial cell growth factor supplement (BD Biosciences, San Jose, CA), 100 units/ml penicillin/streptomycin. All cells were cultured in a 5% CO₂ environment at 37°C. Sodium dichromate (Na₂Cr₂O₇.2H₂O) [Cr(VI)] was obtained from Sigma (St. Louis, MO). Lipofectamine was obtained from InVitrogen (Carlsbad, CA). Hoechst 33342 was from Molecular Probes (Eugene, OR).

Subconfluent cultures of BEAS-2B cells (1×10⁵ cells) in 6-well plates were continuously exposed to 5 µM Cr(VI). Cr(VI)-containing culture medium was changed every 3 to 4 days and the cells were passaged weekly at preconfluent (∼80%) densities. The Cr(VI)-treated cells are designated as BEAS-Cr cells so as to distinguish them from the parental BEAS-2B cells. Parallel cultures grown in Cr(VI)-free medium provided passage-matched controls. After 24 weeks of exposure, Cr(VI)-treated cells were cultured in normal medium and their malignant transformation and tumorigenic properties were assessed as described below.

Cells (1×10⁵ cells) were seeded on 60-mm cell culture dishes. At specific times after the incubation, cells were trypsinized and analyzed for cell number using a Countess® automated cell counter (InVitrogen, Carlsbad, CA).

Soft agar assay was performed as previously described with minor modifications [24]. The cell lines studied (3×10⁴ cells) were mixed with tissue culture medium containing 0.5% agar to result in a final agar concentration of 0.33%. The cell suspension (1.5 ml) was plated into 60-mm dishes coated with 7 ml of 0.5% agar into culture medium. After 2 weeks, the average number of colonies with a size of more than 50 cells was scored under a light microscope.

Cell migration was determined by wound assay as detailed previously [25]. Briefly, monolayer of cells was cultured in 24-well plate, and a wound space was made with 1 mm width tip. After rinsing with PBS, the cell monolayers were allowed to migrate for 24 h. Cell migration was measured by light microscopy and quantified by calculating the percentage of change in the wound space as previously described [25]. Relative cell migration was calculated by dividing the percentage change in the wound space of transformed cells by that of the control cells in each experiment. Invasion assays were performed using Transwell® chambers coated with Matrigel® (50 µl per filter) (BD Biosciences, NJ) according to the manufacturer's protocol. Medium containing 5% FBS was used as a chemo-attractant. After 24 h incubation, cells that invaded to the underside of chamber were stained with Hoechst 33342.

Growth factor-reduced Matrigel® was placed in 24-well plates (150 µl/well) and allowed to set at 37°C for 30 min. HUVEC cells (4×10⁴cells) suspended in 2.5% dialyzed FBS medium were incubated with cell-primed supernatants from epithelial cells (0.5×10⁶ cells/6-well plate) at the ratio of 1 to 1, and added to the Matrigel®-coated plates. Tube formation of HUVEC cells was observed and photographed using a phase contrast microscope after 24 h. The number of nodes formed was scored from at least five different fields for each well.

Apoptosis was determined by Hoechst 33342 DNA fragmentation assay. Briefly, cells were incubated with 10 µg/ml of Hoechst 33342 for 30 min and analyzed for apoptosis by scoring the percentage of cells having intensely condensed chromatin and/or fragmented nuclei by fluorescence microscopy (Leica Microsystems, Bannockburn, IL). Approximately 1,000 nuclei from ten random fields were analyzed for each sample. The apoptotic index was calculated as the percentage of cells with apoptotic nuclei over total number of cells.

Lentiviral transduction particles carrying short hairpin RNA (shRNA) sequence against human Bcl-2 (5′-CCGGGTGATGAAGTACATCCATTATCTCGAGATAATGGATGTACTTCATCA CTTTTG-3′) and control non-target sequence (5′-CCGGCAACAAGATGAAGAGCACCAACT CGAGTTGGTGCTCTTCATCTTGTTGTTTTT-3′) were used to downregulate Bcl-2 expression in BEAS-Cr and H460 cells. The viral vectors were obtained from Sigma (Cat # SHVRS-NM_000633 and SHC002V, respectively) and were used according to the manufacturer's protocol at the multiplicity of infection of 1.5. For generation of stable clones, cells were cultured for 14 days with puromycin at 1 µg/ml concentration. Resistant clones expressing varying levels of Bcl-2 were isolated using cloning cylinders (Bellco Glass, Vineland, NJ) and transferred for expansion and analysis by Western blotting.

Preparation of cell lysates and Western blotting were performed as described previously [16]. We obtained antibodies for Bcl-2, β-actin, and peroxidase-conjugated secondary antibodies from Santa Cruz Biotechnology (Santa Cruz, CA). The immune complexes were detected by chemiluminescence and quantified using analyst/PC densitometry software (Bio-Rad Laboratories, Hercules, CA).

Male athymic (nu/nu) nude mice obtained from Jackson Laboratory (Bar Harbor, ME) were housed under pathogen-free conditions and fed an autoclaved diet and water ad libitum. To establish tumor xenografts in mice, BEAS-2B, BEAS-Cr, H460 and Bcl-2 knockdown cells (1×10⁶ cells) were suspended in 1∶1 medium mixed with Matrigel® and were injected subcutaneously on the left and right flanks of each mouse. Tumor size was measured at 14 days post-injection by using a caliper, and the tumor volume was determined using the formula: 0.5238×L (length)×W (width)×H (height) of the tumor. All procedures were conducted in accordance with the guidelines for the Use and Care of Laboratory Animals and approved by the West Virginia University Institutional Animal Care and Use Committee (WVU IACUC).

The Ingenuity Pathways Analysis (IPA) software (Ingenuity Systems, Redwood City, CA) was used to analyze the currently published Bcl-2 interactome. The Ingenuity database is the largest curated database of previously published findings on mammalian biology from the public literature (i.e., MEDLINE). Reports on individual studies of genes in human, mouse or rat were first identified from peer-reviewed publications, and findings were then encoded into ontology by content and modeling experts. Network analysis using the knowledge base was used to further identify direct interactions between mammalian orthologues. The Bcl-2-interactome is a graphical representation of its published molecular relationships. Molecules are represented as nodes, and the biological relationship between two nodes is represented as an edge (line). Nodes are displayed using various shapes that represent the functional class of the gene product. Edges are displayed with various labels that describe the nature of the relationship between the nodes.

The data were expressed as means ± SD of three or more independent experiments. Statistical analysis was performed using two-tailed and paired Student's t-test. P values less than 0.05 were considered statistically significant and indicated by an asterisk.

Abnormal cell growth is a key characteristic of cancer cells. We determined the growth characteristic of Cr(VI)-transformed cells (BEAS-Cr) generated by chronically exposing non-carcinogenic BEAS-2B cells to Cr(VI) over 24 weeks as described under Materials and Methods. To determine the role of Bcl-2 in the process, the transformed BEAS-Cr cells were first analyzed for Bcl-2 expression and cell growth characteristics. Passage-matched BEAS-2B cells and human lung cancer H460 cells were used as a negative and positive control, respectively. Figure 1A shows that BEAS-Cr cells exhibited a higher level of Bcl-2 protein expression as compared to passage-control BEAS-2B cells, but comparable to H460 cells. To study the role of Bcl-2 in Cr(VI)-induced transformation, mutant cell lines exhibiting stably downregulated Bcl-2 were generated from BEAS-Cr and H460 cells using RNA interference and clonal selection. Figure 2B shows that maximum Bcl-2 downregulation in BEAS-Cr mutants (85%) was achieved in clone 2, whereas maximum reduction in H460 mutants (75%) was obtained in clone 1, which were used in subsequent studies. Figure 1C shows that as compared to control BEAS-2B cells, BEAS-Cr and H460 cells exhibited a significantly higher growth rate which was observed as early as 48 h post-seeding. By 96 h, the growth rates of BEAS-Cr and H460 cells were more than double that of the control BEAS-2B cells. Knockdown of Bcl-2 in BEAS-Cr and H460 cells reduced the growth rates by about 50% at 96 h (Figure 1D).

Soft agar colony formation assays were performed to assess the relative colony forming activities of the cells. BEAS-2B, BEAS-Cr, and H460 cells were subjected to colony formation assay by growing them on agar plates so as to assess anchorage-independent growth. After 2 weeks, significant colony formation was observed in BEAS-Cr cells with a 7-fold increase as compared to passage-control BEAS-2B cells which also formed very few, slow growing colonies (Figure 2A and C). The H460 lung cancer cells exhibited the highest colony formation capacity, out-growing the BEAS-2B cells by approximately 8-fold and BEAS-Cr cells by approximately 1.5-fold. Next, the effect of Bcl-2 knockdown on colony formation capacity was evaluated. The BEAS-Cr mutant exhibited approximately 60% reduction in colony formation, while a 40% reduction was observed in the H460 mutant as compared to their respective controls (Figure 2B and C).

We next investigated the relative aggressive-malignant phenotypes of the cells using the Transwell® invasion and wound migration assays. The H460 cells showed the highest invasion capacity with BEAS-Cr cells invading at the rate of 70% relative to H460, and BEAS-2B invading at 15% (Figure 3A and E). A 7-fold increase in invasion rate was observed in BEAS-Cr as compared to BEAS-2B cells. The highest migration capacity was observed in H460 cells followed by BEAS-Cr cells, at approximately 75% of H460 cells, and finally, BEAS-2B cells, at less than 10% of H460 cells (Figure 3C). Knockdown of Bcl-2 in BEAS-Cr and H460 cells substantially reduced their invasion and migration capacities as compared to controls (Figure 3B, D and E).

Angiogenesis is an essential step in tumor growth. We determined whether Cr(VI)-transformed cells possess an angiogenic activity and whether Bcl-2 regulates this activity by performing vascular endothelial tube formation assay. HUVEC cells were incubated with cell-primed supernatants from BEAS-Cr, H460, or control BEAS-2B cells in Matrigel®-coated plates, and analyzed for endothelial capillary tube formation. Figure 4A and C shows that BEAS-Cr and H460 cell supernatants induced a higher number of branch nodes and a more complex pattern of endothelial tube formation as compared to control BEAS-2B cell supernatants. This result indicates an increase in pro-angiogenic activity of Cr(VI)-transformed cells which may be important in Cr(VI)-induced tumorigenesis that has not been reported. Downregulation of Bcl-2 in BEAS-Cr and H460 cells inhibited their angiogenic activity as compared to controls (Figure 4B and C). This finding indicates a novel and positive regulatory role of Bcl-2 in angiogenesis.

Resistance to apoptosis is a foundation of neoplastic evolution and a key characteristic of cancer cells. We tested whether Cr(VI)-transformed cells exhibited apoptosis-resistant phenotype and whether Bcl-2 plays a role. BEAS-Cr, H460, or control BEAS-2B cells were treated with Cr(VI) and analyzed for apoptosis. Figure 5A shows that Cr(VI) treatment markedly induced apoptosis of control BEAS-2B cells, whereas it had substantially lesser effect in BEAS-Cr and H460 cells. Knockdown of Bcl-2 in BEAS-Cr and H460 cells reversed their apoptosis resistance as compared to their respective controls (Figure 5B and C). The mechanistic similarity between BEAS-Cr and H460 cells suggests that Bcl-2 is a general feature of apoptosis resistance to Cr(VI).

To assess the potential tumorigenicity of Cr(VI)-transformed cells and the role of Bcl-2 in the process, experiments were performed using a xenograft mouse model. BEAS-Cr and H460 cells and their Bcl-2 knockdown mutants were subcutaneously injected into nude mice. At one week after the injection, small tumors were formed at the injection site in mice receiving BEAS-Cr and H460 cells, whereas mice receiving passage-control BEAS-2B cells did not develop tumors. At 14 days post-injection, large tumors were found in the BEAS-Cr (Figure 6A) and H460 (Figure 6B) mice, whereas no or very small lumps were observed in the BEAS-2B control mice. Mice receiving Bcl-2 knockdown mutants, either BEAS-Cr or H460, showed a substantial reduction in tumor volume as compared to their respective controls (Figure 6A and B). These results indicate the role of Bcl-2 in tumorigenesis of Cr(VI)-transformed cells. The inhibition of tumor growth in H460 mutant mice also implicates the general role of Bcl-2 in the tumorigenesis of lung cancer cells.

In order to establish a strategy towards a better understanding of the mechanism(s) involved in Bcl-2's contribution to tumorigenesis, we performed an extensive PubMed database search for possible molecular targets. The initial query for Bcl-2 returned 33,970 hits! We realized that other approaches may need to be evaluated given the complexity of Bcl-2 cellular role(s). Following the analysis of available options, we turned to Ingenuity Pathways Analysis (IPA). IPA integrates the primary literature into easily searched and visualized networks allowing for orders of magnitude faster evaluation of cellular signaling cascades. The initial IPA query of Bcl-2's interactions (IPA v8.6) returned 741 hits. In order to make the network more relevant to our model, we filtered for only those interactions reported in humans (Figure 7). This reduced the interaction network to 56 molecules organized by cellular localization (Bcl-2-interactome). Given that we selectively targeted Bcl-2 and observed significant consequences on tumor-associated properties, we asked IPA to map only the downstream components of human Bcl-2-interactome known to date (Figure 8). The query returned 20 molecules. As we progressed from the initial overwhelming complexity of data to the more manageable and relevant Figure 6B, the current mechanistic evidence of Bcl-2's role in tumorigenesis emerged, as did a new approach to scientific query.

It is likely that multiple genes and signaling pathways are involved in the different effects of Bcl-2. In an effort to understand the mechanism of Bcl-2 regulation in Cr(VI)-transformed cells, we investigated the potential role of p53 since it is known to regulate several proteins in the Bcl-2 family [26] and it is shown by IPA a direct upstream regulator of Bcl-2 (Figure 8). Cells were treated with or without Cr(VI) and analyzed for Bcl-2 and p53 protein levels by Western blotting. In non-treated cells, Bcl-2 expression was substantially lower in the BEAS-2B cells as compared to BEAS-Cr and H460 cells, whereas p53 expression was higher in BEAS-2B cells (Figure 9A). The inverse relationship between Bcl-2 and p53 was also observed in Cr(VI) treated cells across the cell lines tested, indicating the potential negative regulation of Bcl-2 by p53. To test the direct role of p53 in Bcl-2 regulation in Cr(VI)-transformed cells, BEAS-Cr cells were ectopically transfected with p53, and Bcl-2 expression was evaluated by Western blotting. Figure 9B shows that as compared to vector-transfected control, the p53-transfected cells exhibited a substantially lower Bcl-2 expression, indicating p53 as a negative regulator of Bcl-2 in the cell system.