Patient E (
V. N. R., G. K., C. S. K., and T. W. contributed equally to this work.
Members of the Emory Serious Communicable Diseases Unit are listed after the References.
Two patients with Lassa fever are described who are the first human cases treated with a combination of ribavirin and favipiravir. Both patients survived but developed transaminitis and had prolonged detectable virus RNA in blood and semen, suggesting that the possibility of sexual transmission of Lassa virus should be considered.
Lassa fever (LF), a disease endemic to West Africa caused by infection with Lassa virus (family Arenaviridae), causes an estimated 100 000–300 000 human cases annually [
The index patient was a medical worker employed at a missionary institution in Oti District, Togo. The index patient was medically evacuated to Cologne, Germany, after 2 weeks of fevers, but died approximately 10 hours after admission despite intensive care. LF was diagnosed postmortem by reverse-transcription polymerase chain reaction (RT-PCR) from a liver biopsy (Gerd Fätkenheuer, submitted).
Patient E is a previously healthy 33-year-old man who provided 7 days of nursing care to the index patient in Togo and developed fevers 9 days after his last contact with the index patient. A thick blood smear was positive for malaria and he received 3 days of artemether/lumefantrine. LF was suspected when his fevers persisted and he developed sore throat, retro-orbital headache, intermittent diminished hearing, diarrhea, malaise, and generalized weakness. Laboratory testing in Togo revealed leukopenia with a nadir of 1 × 109 cells/L, thrombocytopenia of 50 × 109 cells/L, mild transaminitis (aspartate aminotransferase 131 U/L, alanine aminotransferase 77 U/L), and creatinine of 2.3 mg/dL. Patient E received ribavirin 2 g orally once followed by 1 g every 8 hours as intravenous ribavirin was not immediately available. He was medically evacuated to the Serious Communicable Diseases Unit at Emory University Hospital in Atlanta, Georgia, on day 8. An admission blood specimen was positive for Lassa virus infection by conventional RT-PCR and retrospective quantitative (q) RT-PCR (using laboratory-developed primers LV-Tog2 F (TCACAACTCATCGCCTCATAC) and LV-Tog2 R (AATCTGTATGACCACGCACTC) and of probe LV-Tog2 P (56-FAM/TCCATCTGT/ZEN/CCATCCCAAACTTCAACC/3IABkFQ) with a cycle threshold value (Ct) of 23.4 (
Initial vital signs included temperature 37.1°C, heart rate 50 beats/minute, respiratory rate 24 breaths/minute, and blood pressure 140/91 mm Hg. Examination revealed a thin, ill-appearing male with mild conjunctival pallor, oral thrush, a soft precordial systolic murmur, and mild bladder distension with suprapubic tenderness. Tests for Ebola virus, human immunodeficiency virus (HIV), and malaria were negative. The patient had fevers to a maximum of 40.4°C, which resolved on day 12, and intermittent headaches. He developed nausea, which he attributed to favipiravir. His appetite improved and his sore throat resolved on day 14. He developed painful diffuse lymphadenopathy on day 14, epididymitis between days 19 and 21 (which later correlated to semen culture positivity for Lassa), and night sweats on day 22. He was discharged on day 25. His hearing slowly improved, although subjective right-sided decreased hearing persisted for 4 months despite normal audiological testing.
Patient F is a mortician who prepared the index patient’s corpse for repatriation 11 days after the patient’s death. He was ill with mild upper respiratory tract symptoms prior to contact with the deceased patient, making the first day of symptoms due to LF difficult to clarify. Qualitative PCR for LF was ordered by the health authorities 2 days after contact with the corpse due to temperatures between 37.5°C and 38.0°C (illness day 1) with an inconclusive result (1 faint band in 1 of 3 parallel assays). His condition deteriorated over 3 days with fevers to 38.2°C, pronounced generalized weakness, myalgia, arthralgias, headache, and nausea. Repeat qRT-PCR testing 4 days later was positive (Ct 31.0;
Initial vital signs were temperature 38.9°C, blood pressure 145/75 mm Hg, and heart rate 77 beats/minute. Examination revealed dry mucous membranes, pharyngeal erythema with patchy white exudates, conjunctival injection, a faint macular rash on the epigastrium, and slowed rapport and speech. Diagnostic testing was negative for HIV, hepatitis B and C, influenza, and group A
He received 1000 mg of intravenous ribavirin followed by 1000 mg every 6 hours for 4 days followed by 500 mg intravenously every 8 hours for another 6 days per the World Health Organization protocol [
For both patients, clinical laboratory support was provided as described in
Cell culture by Vero cell culture for Lassa virus was positive from whole blood specimens from patient E on days 8, 9, and 11 and patient F on day 5. Lassa virus nucleic acid was detected in blood samples by qRT-PCR in patient E through day 59 (
We report 2 epidemiologically linked patients with LF secondarily acquired from the same index case treated with favipiravir and ribavirin and who made full recovery. Ribavirin, the only previously described anti-LF therapy associated with reduced mortality in humans, was initiated on day 6 (patient E) and day 5 (patient F). Favipiravir is licensed for influenza treatment in Japan and may reduce mortality in other RNA virus infections, including Ebola virus disease [
Viral nucleic acid was detected for a prolonged period in both patients in blood (days 27 and 62) and semen (days 48 and 103). The long-term persistence of viable virus in convalescent patients in immune-privileged compartments has been described for Ebola virus in ocular and seminal fluid [
We thank Sarah Katharina Fehling and Svenja Wolff for virus isolation work and Michael Schmidt and Gotthard Ludwig for technical support in the biosafety level 4 facility at the Philipps University of Marburg. We express our gratitude to the nursing staff of the intensive care pool and the Infectious Diseases Department, University Hospital Frankfurt. We thank Debi Cannon, Cheng-Feng Chiang, William Davis, Aridth Gibbons, James Graziano, Mary Jenks, Maria Morales-Betouille and Nishi Patel for their assistance in performance of the laboratory testing at the Centers for Disease Control and Prevention (CDC). We are appreciative of the support of the US Food and Drug Administration, Valeant, and Medivector for the provision of the therapeutics for these patients. We thank the Investigational Drug Service at Emory University and the Emory University Institutional Review Board.
T. W., G. K., and C. S. K.: Treated the patient, collected data, wrote the manuscript. S. B. and M. E.: Performed virological analysis, assisted in writing the manuscript, provided discussion of results. T. S.: Performed virological analysis, analyzed data. P. L.: Treated the patient, collected data. G. S.: Treated the patient. C. S.: Treated the patient, provided discussion of the manuscript. H. R.: Assisted in sample and data collection, provided discussion of the manuscript. V. N. R.: Collected data, wrote the manuscript. A. M.: Collected data, edited the manuscript. B. S. R., J. B. V., A. K. M., G. M. L., S. V., and K. F.: Treated the patient, collected data, edited the manuscript. S. B., J. D. K., P. E. R., U. S., S. N.: Performed virological analysis, analyzed data, edited the manuscript. K. P.: Performed virological analysis, analyzed data. A. M.: Performed virological analysis, assisted in writing the manuscript, provided discussion of results.
The findings and conclusions in this report are those of the authors and do not necessarily represent the official position of the CDC.
Patient E (