The genome of one Chinese
The apicoplast and mitochondrial genomes of
The apicoplast and mitochondrial genomes of
Human cyclosporiasis is caused by
One major reason for the lack of molecular diagnostic tools and poor understanding of the basic biology of
Apicoplasts and mitochondria are two important intracellular organelles of apicomplexan parasites [
As there are no data on the apicoplast genome and only partial data on the mitochondrial genomes of
DNA was extracted from a
PCR amplification and sequencing of the amplicons were used to confirm the inverted repeats in the plastid genome. Two pairs of primers were used to amplify the regions that join the inverted repeat to the main body of the apicoplast. The primer sets were F1: 5′-AGT CGC TAA GTA GCC AAG TTT-3′ and R1: 5′-TTG TCT TGC CTG TGC TAT AGT AAT-3′, and F2: 5′- ACT ACA TCA ACG GCT AAC T-3′ and R2: 5′-GTA CGA GAG GAC CAA AGA AA-3′, which targeted a 634 (between rps4 and LSU rRNA genes) and 743 bp fragment (between ycf24 and LSU rRNA genes), respectively. The reactions contained 1 μl of DNA, 1× GeneAmp PCR buffer (Applied Biosystems, Foster City, CA), 1.5U of GoTaq polymerase (Promega, Madison, WI), 250 μM dNTPs (Promega), 3 mM MgCl2, 250 nM of each primer, and 400 ng/μl of non-acetylated bovine serum albumin (Sigma-Aldrich, St. Louis, MO). The amplification was performed on a GeneAmp PCR 9700 thermocycler (Applied Biosystems), consisting of an initial denaturation at 94 °C for 5 min; 35 cycles at 94 °C for 45 s, 55 °C for 45 s, and 72 °C for 1 min; and a final extension at 72 °C for 7 min. The secondary PCR products were detected by 1.5 % agarose gel electrophoresis, and sequenced in both directions using the BigDye Terminator V3.1 Cycle Sequencing Kit (Applied Biosystems) on an ABI 3130xl Genetic Analyzer (Applied Biosystems).
As the apicoplast and mitochondrial genomes of
The 454 and Illumina sequence reads were mapped to reference genomes and assembled sequence contigs using the CLC Genomics Workbench 7.0.3 (
Full genome sequences for apicoplasts and mitochondria of other apicomplexans were extracted from GenBank and aligned with
Nucleotide sequence data from the whole genome sequencing, including the SRA data and assembled contigs, were submitted to NCBI BioProject PRJNA256967. Sequences of the annotated apicoplast and mitochondrial genomes were deposited in the GenBank database under accession numbers KP866208 and KP796149.
Altogether, 46.8 Mb of nucleotides in 4,811 assembled contigs (N50 = 55,741 bp) were obtained from the whole genome sequencing by 454 and Illumina technologies. Blast analysis of the sequences identified sequences of the complete apicoplast and mitochondrial genomes of
The apicoplast genome is 34,155 bp in size with the following base composition: A (40.28 %), T (37.76 %), C (10.79 %) and G (11.16 %), with an overall AT content of 78.04 %. It contained two inverted repeats (IR). Each IR unit is 5,244 bp in length and contains genes coding for an SSU rRNA, an LSU rRNA, and nine tRNAs (Fig. Map of the apicoplast genome of PCR analysis of the regions joining the inverted repeat (IR) and the remainder of the Sequence differences between two inverted repeats (IR) of the apicoplast genome of
aThe variable fragment is located in a 58-bp region (5′- CTATAACGGTCCAAAGGTAGCGAAATTCCTTGTCGGGTAAGTTCCGACCTGCACGAA-3′) of the LSU rRNA gene of each IR
bDash indicates a nucleotide deletionReference position Reference Alleleb
Count Coverage (fold) Allele frequency (%) Mean read quality score 4096 C - 272 413 65.86 28.94 4098 A C 265 414 64.01 30.84 4100 A G 271 420 64.52 30.46 4117 G A 300 462 64.94 30.19 4136 G A 276 417 66.19 31.3 4142 A T 241 380 63.42 27.8 4149 C T 210 340 61.76 30.39 4153 A T 198 324 61.11 29.71 29970 T A 171 302 56.62 30.46 29974 G A 180 320 56.25 31.23 29981 T A 218 358 60.89 28.16 29987 C T 249 390 63.85 30.38 30006 C T 275 418 65.79 30.59 30023 T C 241 388 62.11 30.16 30025 T G 240 387 62.02 30.48 30027 G - 246 385 63.90 28.14
The annotation of the sequences indicated that there are 65 genes coded by the apicoplast genome, including 4 rRNA genes, 28 protein-coding genes, and 33 tRNA genes for all 20 amino acids. The protein-coding genes include 6 genes for ribosomal protein large subunit (rpl), 10 genes for ribosomal protein small subunit (rps), 3 genes for RNA polymerase (rpo), 6 genes for hypothetical proteins, and 1 gene each for elongation factor Tu (tufA), ATP-dependent Clp protease (clpC) and putative ABC transporter (ycf24). The
Rpl2, rps11 start with the codon ATT and rpl11 starts with codon ATA. The start codon for rpoC1 is unclear. By comparing the same gene in
A Blast search of the NCBI database with the Synteny in gene organizations between Distribution of SNVs along apicoplast (
In a maximum likelihood analysis of apicoplast genome sequences from apicomplexans, Maximum likelihood phylogeny of apicoplast (
Single contigs containing the complete mitochondrion genome were identified by Blast analysis of the assembly of sequences from the whole genome sequencing project. The overlapped ends of the contigs generated in different genome assembly efforts indicated that the mitochondrion genome was either circular or concatemeric. This was supported by read mapping at the joint region between two mitochondrial genome units (Fig. Nucleotide sequences at the joint region of the concatenated mitochondrial genomes of
Blast analysis indicated that
Eight single-nucleotide variants (SNVs) and one 7-bp multiple-nucleotide variant (MNV) were detected between the mitochondrial genomes of the Nucleotide sequence differences in the mitochondrial genome of
aAccording to GenBank sequence KP658101Nucleotide positiona
Gene or region Nucleotide in Cyclo_CDC_2013 Nucleotide in CHN_HEN01 60 SSU/8 T A 2007 cox1 G A 2253 cox1 G A 3131 Intergenic between LSU/12 & SSU/1 T A 3964 Intergenic between LSU/8 & SSU/5 C A 4282 LSU/1 A T 4703 cox3 C T 4937 cox3 C T 6085–6091 Intergenic between SSU/11 & SSU9 and within SSU9 TAATAAC GTTATTA
In this study, the complete apicoplast genome of
Phylogenetic analysis of both apicoplast and mitochondrial genomes from a diverse group of apicomplexans supports the close relationship between
The structure of the mitochondrial genome of
Some sequence differences have been observed between mitochondrial genomes of this and the published studies. Altogether, there are eight SNVs and one MNV between genomes of the Chinese isolate examined in this study and the 2013 Texas outbreak isolate in the previous report [
With the whole apicoplast and mitochondrial genome sequences available, better intervention measures and diagnostic tools can potentially be developed for
In conclusion, data on the complete apicoplast and mitochondrial genomes of
The study was done under Human Subjects Protocol No. 990115 “Use of residual human specimens for the determination of frequency of genotypes or sub-types of pathogenic parasites,” which was reviewed and approved by the Institutional Review Board of the Centers for Disease Control and Prevention (CDC). No personal identifier was associated with the
Kevin Tang and Yaqiong Guo contributed equally to this work.
The authors declare that they have no competing interests.
YF and LX conceived and designed the experiments; KT, YG, LZ, LAR, DMR, MAF and NL performed the experiments; KT, YG, SL, and LX analyzed the data; KT, YG, YF and LX wrote the paper. All authors read and approved the final manuscript.
This work was supported in part by the National Natural Science Foundation of China (31425025 and 31110103901) and the US Centers for Disease Control and Prevention.
The findings and conclusions in this report are those of the authors and do not necessarily represent the views of the US Centers for Disease Control and Prevention.