Acetone (HPLC grade; CAS No. 67-64-1), 4,4’-methylene diphenyl diisocyanate (MDI, 98%; CAS No. 101-68-8), 3Å molecular sieve (4-8 mesh; CAS No. 308080-99-1), Tween-20 (CAS No. 9005-64-5), dimethyl sulfoxide (DMSO; CAS No. 67-68-5), phorbol 12-myristate 13-acetate (PMA; CAS No. 16561-29-8), butyric acid (Cas No. 107-92-6), bovine serum albumin (BSA; CAS No. 9048-46-8), tris-buffered saline (TBS), and reduced-glutathione (GSH; CAS No. 70-18-8) were acquired from MilliporeSigma (St. Louis, MO). Roswell Park Memorial Institute (RPMI)-1640 culture medium, Phosphate buffered saline (PBS), and Penicillin-Streptomycin-Glutamine (PSG; 100×) were acquired from ThermoFisher Scientific (Waltham, MA). Hyclone^™ fetal bovine serum (FBS) was obtained from Cytiva Life Sciences (Marlborough, MA). Dry acetone was prepared by incubating HPLC grade acetone with 3Å molecular sieves for a minimum of 24 h to adsorb water.

Cell culture and differentiation were carried out as previously described (Lin et al. 2021; 2024a). Briefly, THP-1 (ATCC^® TIB-202^™), Clone 15 HL-60 (HL-60_C15; ATCC^® CRL-1964^™), and Jurkat Clone E6-1 (Jurkat_E6-1; ATCC^® TIB-152^™) cells were obtained from American Type Culture Collection (ATCC; Manassas, VA) and maintained at 0.5 – 1 × 10⁶/ml in complete RPMI media (RPMI-1640 media supplement, 10% FBS, 1 × PSG) at 37°C in a humidified atmosphere with 5% CO2 (Lin et al. 2021). THP-1 cells (2 × 10⁶ cells) were differentiated using 10 ng/ml PMA in 10-cm culture dishes for 72 h. The PMA-differentiated THP-1 macrophages were enhanced by washing twice with PBS following removal of PMA and incubation of the cells in PMA-free fresh complete media for another 72 h. A concentration of 10 ng/ml PMA has been shown to enhance the macrophage response to polarizing stimuli (Baxter et al. 2020; Maess et al. 2014). All in vitro cell experiments described in this study used differentiated/enhanced THP-1 macrophages. For eosinophil differentiation in chemotaxis experiments, HL-60_C15 cells (5 × 10⁵ cells/ml) were cultured in complete RPMI-1640 media containing 0.5 mM butyric acid for 7 days as previously described (Badewa et al. 2002; Fischkoff 1988; Tiffany et al. 1995).

MDI-GSH conjugate was prepared as previously described (Lin et al. 2020; 2021; 2024a; Wisnewski et al. 2013). Briefly, 10 mM GSH in 200 mM sodium phosphate buffer (pH = 7.4) was prepared. Dry acetone was freshly prepared and 50 μl 10% MDI (w/v) in dry acetone were added to 25 mL of GSH solution dropwise with stirring. In our early studies, treatment of THP-1 macrophages directly with 10 μM of MDI in dry acetone induced extensive cytotoxicity (data not shown), however, the THP-1 macrophages tolerate MDI-GSH reaction products with little observed cytotoxicity. MDI-GSH conjugate reactions were performed at 25 °C with end-over-end mixing for 1 h and then centrifuged 5 min at 10,000 × g and filtered with a 0.2 μm syringe filter to remove any precipitate that may have formed during the conjugation procedure. Of note, this reaction generates a mixture of products including mono and bis-MDI-GSH and methylenedianiline (MDA) (Wisnewski et al. 2013), however the relative amounts of each of these components has not been determined. Freshly prepared MDI-GSH conjugate was immediately added into differentiated/enhanced THP-1 macrophages at 0, 1, and 10 μM nominal MDI concentration as indicated.

Plasmids were constructed similar to previous reports (Lin et al. 2020; 2024a; 2024b). The circRNA overexpression vector, pcDNA3.1⁽⁺⁾_CircRNA_Mini Vector, was obtained from Addgene (plasmid id#60648; Watertown, MA), deposited by Dr. Jeremy Wilusz at Baylor College of Medicine (Liang and Wilusz 2014). To generate a wildtype (WT) hsa_circ_0099188 overexpression plasmid, a 0.34-kb cDNA fragment representing the full length of human circRNA hsa_circ_0099188 was amplified by PCR using forward and reverse primers containing PacI and HpaI restriction sites, respectively. The forward and reverse primers are: PacI restriction site containing forward primer (cccttaattaaTACCTAAAAATAACTGAGATACAG) and HpaI restriction site containing reverse primer (cccgttaacCTTAATTCAACTTTCCTTTATGTA). The PCR product was treated with PacI and HpaI. This fragment was inserted into pcDNA3.1⁽⁺⁾_CircRNA_Mini Vector that was prepared by sequential enzyme treatments with PacI, SacII, and calf intestinal alkaline phosphatase (CIP) to generate pcDNA3.1⁽⁺⁾_Circ_Mini-hsa_circ_0099188 overexpression plasmid.

Nucleic acid transfections were performed as previously described (Lin et al. 2020; 2021; 2023; 2024a). Briefly, for the circRNA overexpression study, 1 × 10⁶ differentiated/enhanced THP-1 macrophages were reverse transfected with 2.5 μg of either pcDNA3.1⁽⁺⁾_CircRNA_Mini-hsa_circ_0099188, or pcDNA3.1⁽⁺⁾_CircRNA_Mini Vector using Mirus TransIT^®-2020 transfection reagent for 48 h. Total RNA was then isolated using the mirVana^™ miR Isolation Kit (ThermoFisher Scientific) according to the manufacturer’s instructions. For functional analyses on binding and regulation with hsa_circ_0099188, the following mirVana^™ miRNA inhibitors (MH; Cat#4464084) and miR-mimics (MC; Cat#4464066) were obtained from ThermoFisher Scientific and diluted to 20 μM in nuclease-free water: hsa-miR-206-3p (MH10409, MC10409), hsa-miR-381-3p (MH10242, MC10242), mirVana^™ miRNA Inhibitor, negative control #1 (Cat#4464076), and mirVana^™ miRNA Mimic, negative control #1 (Cat#4464058). For circRNA hsa_circ_0099188 knockdown studies, two Dharmacon custom siRNAs targeting hsa_circ_0099188 were synthesized and the ON-TARGETplus Non-targeting Control Pool (Cat# D-001810-10-05) were purchased from Horizon Discovery (Lafayette, CO). The custom-designed siRNA sequences are: si-hsa_circ_0099188#1 (Sense): 5’-GGAAAGUUGAAUUAAGUACCUUU-3’; si-hsa_circ_0099188#1 (Antisense) 5’-AGGUACUUAAUUCAACUUUCCUU-3’; si-hsa_circ_0099188#2 (Sense): 5’-AUUAAGUACCUAAAAAUAACUUU-3’; si-hsa_circ_0099188#2 (Antisense): 5’-AGUUAUUUUUAGGUACUUAAUUU-3’. As previously described, differentiated/enhanced THP-1 macrophages were reverse transfected and forward transfected after 24 h (Lin et al. 2011). Total RNA was prepared for RT-qPCR expression analyses 24 h following forward transfection.

To assess the expression of endogenous circRNA hsa_circ_0099188 in differentiated/enhanced THP-1 macrophages, total RNA was extracted using mirVana^™ miR Isolation Kit (ThermoFisher Scientific). First, linear RNA species were depleted by treating 3 μg of purified THP-1 total RNA with 20 U Ribonuclease R (RNase R; LGC Biosearch Technologies, Teddington, UK). 3 μg total RNA, 20 U of RNase inhibitor (Cat# N8080119; ThermoFisher Scientific), 1 × RNase R buffer and 20 U of RNase R in a total volume of 20 μl was incubated at 37°C for 30 min. Control reactions were performed without RNase R. After RNase R treatment, the RNA was further purified using mirVana^™ miR Isolation Kit (ThermoFisher Scientific) according to manufacturer’s instructions. RNase R protein was removed during the second RNA purification step using the mirVana^™ miR Isolation Kit to ensure the sample was free of proteins. Total RNA, with or without RNAse R treatment, was reverse transcribed to cDNA using a High-Capacity cDNA Synthesis Kit (Thermo Fisher Scientific) following the manufacturer’s protocol. PCR reactions were carried out using either TRHDE convergent primers (TRHDE-F: AGAGCACCACAGAATAACTTATTTG; TRHDE-R: GGTCATAGTTGACTCTAAAATAGCC) or circRNA hsa_circ_0099188 divergent primers (di-hsa_circ_0099188-F: TGACTAGAATGAGAAGCTGGGT; di-hsa_circ_0099188-R: CCCTTCCCAGGAGGTCTGTA).

The mRNA, circRNA and miR levels in THP-1 total RNA were analyzed using RT-qPCR as previously described (Lin et al. 2020; 2021; 2023; 2024a; 2024b; Lin et al. 2019; Lin et al. 2011). Briefly, all RT-qPCR reactions were normalized to human beta-2 microglobulin (B2M) for mRNA analysis, or to U6 snRNA for circRNA and miR analysis. TaqMan gene expression and miR specific assays were purchased from ThermoFisher Scientific and include human PPP3CA (Cat#4331182; Assay ID: Hs00174223_m1), KLF4 (Hs00358836_m1), TRHDE (Hs01072025_m1), NOS2 (Hs01075529_m1), CD206 (Hs00267207_m1), TGM2 (Hs01096681_m1), CCL17 (Hs00171074_m1), CCL22 (Hs01574247_m1), CCL24 (Hs00171082_m1), and B2M (Hs00187842_m1), hsa-miR-381-3p (Cat# 4427975; Assay ID No. 000571; hsa/Homo sapiens), and U6 snRNA (No. 001973). For circRNA assays, SYBR Green-based qPCR was performed using PowerTrack^™ SYBR Green Master Mix from ThermoFisher Scientific (Cat#A46110) with divergent primer sets listed in Supplemental Table 1 and normalized using U6 snRNA with following primer sequences: U6_snRNA-F: CTCGCTTCGGCAGCACA; U6_snRNA-R: AACGCTTCACGAATTTGCGT. PCR reactions were conducted on an ABI 7500 Real-Time PCR System (ThermoFisher Scientific, Waltham, MA, USA). Expression of circRNA, mRNAs and miRs were determined using the ^ΔΔCT method (Livak and Schmittgen 2001) and presented as fold change.

The miR-containing RNA inducing silencing complex (miR/RISC) and its targeting circRNA(s) were immunoprecipitated (IP) using the miRNA target IP kit (Active Motif, Carlsbad, CA) as previously described (Lin et al. 2020; 2021; 2023; 2024a). Briefly, differentiated/enhanced THP-1 macrophages were trypsinized and seeded at 8 × 10⁶ cells in a 10-cm dish. The macrophages were transfected with 25 nM of either miR-mimic-206-3p, miR-mimic-381-3p or miR-mimic negative control #1 (Cat# 4464058) for 24 h. For each IP reaction, two 10-cm dishes containing an equal number of 1.6 × 10⁷ cells were used. The cells were lysed, and the lysates were divided into two equal aliquots. Each aliquot underwent IP using either a pan-AGO antibody (to precipitate the RISC containing AGOs/miRs/mRNAs/circRNAs) or an isotype IgG antibody control. The precipitate was collected, and RNA was purified from the precipitate using the mirVana^™ miR Isolation Kit (ThermoFisher Scientific). The RNA was then reverse transcribed to cDNA using the High-Capacity cDNA Reverse Transcription Kit (ThermoFisher Scientific) and hsa_circ_0099188 divergent primer was combined with PowerTrack^™ SYBR Green Master Mix for RT-qPCR reactions. Data was analyzed by comparing the cells transfected with miR-mimics or non-target miR-mimic-control and the fold enrichment of hsa_circ_0099188 was calculated from the anti-panAGO and the IgG isotype antibody IP preparations as per manufacturer’s instructions.

Secreted protein concentrations of CCL17, CCL22 and CCL24 in conditioned media were determined as previously described (Lin et al. 2023; 2024a). Briefly, conditioned media was collected 48 h after transfecting differentiated/enhanced THP-1 macrophages with 2.5 μg of either pcDNA3.1⁽⁺⁾_CircRNA_Mini-hsa_circ_0099188 overexpression plasmid or empty pcDNA3.1⁽⁺⁾_CircRNA_Mini vector. The following enzyme-linked immunosorbent assay (ELISA) kits were obtained from R&D systems (Minneapolis, MN): Human CCL17/TARC ELISA kit (Cat#DY364); Human CCL22/MDC (Cat#DY336), and human CCL24/Eotaxin-2 (#DY343). The sensitivity of each chemokine is as follows: CCL17 (7.8 pg/ml), CCL22 (7.8 pg/ml), and CCL24 (31.2 pg/ml). The levels of human CCL17, CCL22, and CCL24 chemokines released into the conditioned media from plasmid-transfected THP-1 macrophages were determined by ELISA according to manufacturer’s directions.

Chemotaxis/cell migration in response to conditioned media collected from THP-1 macrophages treated with pcDNA3.1⁽⁺⁾_CircRNA_Mini-hsa_circ_0099188 overexpression plasmid or pcDNA3.1⁽⁺⁾_CircRNA_Mini vector were performed as previously described (Lin et al. 2021; 2023; 2024a). Briefly, chemotaxis/cell migration assays were conducted in a 24-well plate with Transwell^™ inserts (3 μm pore, Corning^™ Transwell^™ plates, ThermoFisher Scientific). Naive T-cells (Jurkat_E6-1 T cells) or eosinophils (butyric acid differentiated HL-60_C15 cells) were seeded at 1 × 10⁶ cells in 100 μl serum-free RPMI 1640 media in the upper chamber while 500 μL of cell-free conditioned media from THP-1 macrophages was transfected with either pcDNA3.1⁽⁺⁾_CircRNA_Mini-hsa_circ_0099188 overexpression plasmid or the empty vector was added into the lower chamber as chemoattractant. The cells were incubated for 6 h at 37 °C in a 5% CO₂ humidified incubator. Cells that migrated into the lower chamber media were collected and stored on ice. Cells that failed to migrate from the upper chamber were aspirated and discarded. The Transwell inserts were washed twice with PBS, and 500 μl cell detaching media (0.25% Trypsin-EDTA, Cat#25200056, ThermoFisher Scientific) was added to the lower chambers followed by reinstallation of the upper chamber. The whole plate was further incubated for 30 min at 37 °C to detach the remaining migrated cells. After incubation, detached cells were combined with the previously collected migrated cells in conditioned media, centrifuged at 300 × g for 5 min, washed twice with PBS, and stored at −80 °C. The total number of migrated cells was quantified using CyQUANT^® Cell proliferation assay (ThermoFisher Scientific) according to manufacturer’s instructions.

Statistical analysis was performed as previously described (Lin et al. 2020; 2021; 2023; 2024a). Briefly, data were analyzed using either the unpaired t-test (two-tailed) when comparing two groups, or one-way analysis of variance followed by Tukey’s multiple comparison ad hoc post-test when comparing multiple groups. Statistical analyses were performed in GraphPad Prism 10.3.0 (GraphPad Software, La Jolla, CA, USA.). P < 0.05 was used to assign significance.

Our previous reports demonstrated that exposure to MDI/MDI-GSH conjugates, both in vivo and in vitro, leads to the downregulation of endogenous mmu/hsa-miR-381-3p in bronchoalveolar lavage cells (BALCs) from an MDI-exposed mouse model and in THP-1 macrophages treated with acute MDI-GSH conjugates (Lin et al. 2020; 2021). These findings suggest that MDI/MDI-GSH conjugates downregulate endogenous hsa-miR-381-3p through an unknown mechanism in alveolar macrophages. Through a PubMed literature search (09/2024), we identified four endogenous circRNAs including hsa_circ_0021593 (Gu et al. 2020), hsa_circ_0038467 (Yang et al. 2024), hsa_circ_0084003 (Zhang et al. 2019), and hsa_circ_0099188 (Sun et al. 2022) that have been reported to bind/sponge and regulate the levels and function of hsa-miR-381-3p in various cell types. To investigate whether MDI/MDI-GSH conjugate exposure alters the expression of these candidate circRNAs, we used differentiated/enhanced human THP-1 macrophages as an in vitro model. The circRNA responses to MDI-GSH conjugate exposure and subsequent cellular signaling pathways were examined in the following experiments. Differentiated/enhanced THP-1 macrophages were treated with MDI-GSH conjugates at concentrations of 0, 1, and 10 μM for 24 hours. Endogenous hsa-miR-381-3p and candidate circRNA levels were quantified by RT-qPCR using TaqMan assays for hsa-miR-381-3p and specific divergent primers for the candidate circRNAs (Supplemental Table 1). Consistent with our previous findings, MDI-GSH conjugate treatments significantly downregulated endogenous hsa-miR-381-3p levels, with reductions ranging from 16.3% to 6.1% of control (Fig. 1A). Among the four identified candidate circRNAs, MDI-GSH treatment upregulated the levels of hsa_circ_0099188 by 1.42- to 3.04-fold (Fig. 1E), while the levels of hsa_circ_0021593 remained unchanged (Fig. 1B). We were unable to detect the other candidate circRNAs, hsa_circ_0038467 and hsa_circ_0084003, in THP-1 macrophages with or without MDI-GSH treatment (Fig. 1C and D). These results indicate that exposure to MDI-GSH conjugates can upregulate endogenous hsa_circ_0099188 while downregulating hsa-miR-381-3p in macrophages.

In silico queries (09/2024) of the circBase (Glažar et al. 2014) and Circular RNA Interactome database (Dudekula et al. 2016) showed that the mature hsa_circ_0099188 consists of 341 nucleotides and is backspliced from intron 2 of the host gene TRHDE, located on chromosome 12 (Fig. 2A). The TRHDE mRNA transcript (NM_013381) includes 19 exons after splicing and spans 11,047 nucleotides (Fig. 2B). CircRNA hsa_circ_0099188 is derived from intron 2 of the TRHDE RNA transcript via a backsplicing mechanism during TRHDE mRNA maturation in the nucleus (Fig. 2B). To confirm the expression of hsa_circ_0099188 in THP-1 macrophages, total RNA isolated from differentiated/enhanced THP-1 macrophages was treated with RNase R to degrade linear RNA species, and RT-PCR was performed using TRHDE convergent primers (designed to detect mature TRHDE mRNA) and hsa_circ_0099188 divergent primers (designed to detect mature hsa_circ_0099188) (Fig. 2B). We successfully detected hsa_circ_0099188 in THP-1 RNA, whether treated with or without RNase R, using the hsa_circ_0099188 divergent primers. However, we could not detect TRHDE mRNA expression in RNase R-treated THP-1 RNA using the TRHDE convergent primers (Fig. 2C). This result confirms that hsa_circ_0099188 is expressed in THP-1 macrophages. To determine whether MDI-GSH conjugate exposure regulates hsa_circ_0099188 by upregulating its host gene TRHDE, differentiated/enhanced THP-1 macrophages were treated with MDI-GSH conjugates at concentrations of 0, 1, and 10 μM for 24 hours. The results showed that TRHDE transcript levels were significantly upregulated by MDI-GSH treatment, with increases ranging from 1.22- to 1.68-fold (Fig. 2D). These findings suggest that hsa_circ_0099188 is expressed in THP-1 macrophages, and exposure to MDI-GSH conjugates upregulates hsa_circ_0099188 through induction of TRHDE RNA transcription in macrophages.

Previous studies have shown that hsa_circ_0099188 can target and sponge hsa-miR-381-3p in human lung fibroblast WI-38 cells (Sun et al. 2022). However, it is not certain whether hsa_circ_0099188 regulates hsa-miR-381-3p in macrophages. To explore the molecular mechanism by which hsa_circ_0099188 may regulate hsa-miR-381-3p through sponging or targeting, we analyzed the potential binding between hsa_circ_0099188 and hsa-miR-381-3p using the in silico tool Circbank (http://www.circbank.cn/)(Liu et al. 2019). We identified one potential miR response element (MRE) site for hsa-miR-381-3p located at position 158–181 of hsa_circ_0099188 (Fig. 3A), but no MRE site for hsa-miR-206-3p was found (data not shown).

CircRNAs are usually stable with long half-lives due to their closed circular structure (lacking the 5’- or 3’-ends of linear RNA species that can be targeted for degradation by exonucleases). However, studies have shown that circRNA degradation can occur when miRs bind to them. This binding facilitates the recruitment of Argonaute (AGO) proteins from RNA-induced silencing complexes (RISC) to circRNAs through the MRE sites, leading to direct RNA cleavage by AGO proteins. This cleavage generates free ends on the circRNA, exposing it to exonucleases for degradation (Zhou et al. 2021). To investigate whether hsa_circ_0099188 is directly regulated by hsa-miR-206-3p or hsa-miR-381-3p, we first confirmed the binding of hsa-miR-206-3p or hsa-miR-381-3p to hsa_circ_0099188 by performing an AGO antibody pulldown assay. This method precipitates RISC containing AGOs, miRs, and circRNAs (RISC-IP; RIP), followed by analysis of the regulatory roles of these miRs on hsa_circ_0099188 using gain- or loss-of-function studies with miR mimics or inhibitors. Consistent with the in-silico prediction, which suggested that hsa_circ_0099188 contains an MRE site for hsa-miR-381-3p but not for hsa-miR-206-3p, transfection of miR-mimic-381-3p resulted in a 5.16-fold increase in the precipitation of hsa_circ_0099188 compared to a non-targeting miR-mimic control. In contrast, transfection of miR-mimic-206-3p did not increase the precipitation of hsa_circ_0099188 compared to the control (Fig. 3B). These results confirm that hsa_circ_0099188 binds to hsa-miR-381-3p but not to hsa-miR-206-3p within RISC complexes.

To further investigate whether hsa-miR-381-3p regulates endogenous hsa_circ_0099188 through sponging or miR-mediated degradation in differentiated/enhanced THP-1 macrophages, we conducted gain- and loss-of-function experiments by transfecting miR mimics or inhibitors of hsa-miR-206-3p and hsa-miR-381-3p into the macrophages. Transfection of miR-mimic-381-3p caused a 51.9% reduction of endogenous hsa_circ_0099188 (Fig. 3C), whereas transfection of miR-inhibitor-381-3p upregulated hsa_circ_0099188 by 4.96-fold (Fig. 3D), compared with the non-targeting controls. To further examine the binding/sponging/degradation mechanism, we transfected THP-1 macrophages with miR mimics or inhibitors for hsa-miR-206-3p. Because hsa_circ_0099188 does not contain an MRE site for hsa-miR-206-3p, neither miR-mimic-206-3p nor miR-inhibitor-206-3p altered the levels of hsa_circ_0099188 (Fig. 3C and D). These findings provide further evidence that hsa_circ_0099188 interacts with hsa-miR-381-3p through the MRE site on hsa_circ_0099188 and can be regulated by endogenous hsa-miR-381-3p in macrophages.

To investigate the endogenous roles of hsa_circ_0099188 in regulating hsa-miR-381-3p, we designed two distinct siRNAs targeting hsa_circ_0099188 and performed a loss-of-function experiment. Differentiated/enhanced THP-1 macrophages were transfected with either si-hsa_circ_0099188#1 or si-hsa_circ_0099188#2, which target different regions of the circRNA hsa_circ_0099188. Transfection of si-hsa_circ_0099188#1 resulted in a significant reduction of endogenous hsa_circ_0099188 levels by 64.3%, while si-hsa_circ_0099188#2 reduced hsa_circ_0099188 levels by 32.9% (Fig. 4A). In line with our previous findings that hsa_circ_0099188 acts as a sponge/target for hsa-miR-381-3p in macrophages (Fig. 3), silencing of hsa_circ_0099188 with si-hsa_circ_0099188#1 significantly increased endogenous hsa-miR-381-3p expression by 3.53-fold, whereas transfection with si-hsa_circ_0099188#2 resulted in a 1.56-fold increase in hsa-miR-381-3p levels (Fig. 4B). These results suggest that endogenous hsa_circ_0099188 plays a role in regulating the levels of hsa-miR-381-3p in macrophages.

Our previous studies demonstrated that MDI/MDI-GSH exposure upregulates calcineurin/NFAT signaling activation, leading to NOS2 upregulation through hsa-miR-206/381-3p-mediated PPP3CA upregulation (Lin et al. 2020). Furthermore, MDI/MDI-GSH exposure upregulates the transcription factor KLF4, as well as M2 macrophage-associated markers and chemokines, including CCL17, CCL22, and CCL24, through KLF4-mediated activation in macrophages (Lin et al. 2023). Further investigation revealed that KLF4 transcription factor can be regulated by endogenous hsa-miR-381-3p in macrophages (Lin et al. 2024b). To examine the role of hsa_circ_0099188 in regulating the MDI-GSH conjugate-induced activation of calcineurin/NFAT signaling mediated NOS2 transcription, and M2 macrophage-related gene expression, we performed a loss-of-function experiment using si-hsa_circ_0099188 siRNA to knock down endogenous hsa_circ_0099188 in macrophages. Since si-hsa_circ_0099188#1 exhibited stronger knockdown of hsa_circ_0099188 compared to si-hsa_circ_0099188#2 (Fig. 4A), we focused on the use of si-hsa_circ_0099188#1 for subsequent experiments. Transfection with si-hsa_circ_0099188#1 reduced the expression of endogenous hsa_circ_0099188, PPP3CA, KLF4, and TGM2 mRNAs by 59.0%, 45.6%, 65.9%, and 40.8%, respectively (Fig. 5 A, C, D, and G), and increased hsa-miR-381-3p expression by 1.61-fold (Fig. 5 B) compared to control nontargeting siRNA (siCtl)-treated THP-1 macrophages. Consistent with our previous findings that MDI-GSH conjugate exposure upregulates PPP3CA and NOS2 (Lin et al. 2020), KLF4 and M2 macrophage-related markers and chemokines in THP-1 macrophages (Lin et al. 2023), as well as hsa_circ_0099188 (Fig. 1), treatment with 10 μM MDI-GSH conjugates in siCtl-transfected macrophages increased the expression of hsa_circ_0099188, PPP3CA, KLF4, NOS2, CD206, TGM2, CCL17, CCL22, and CCL24 mRNAs by 6.09-, 2.80-,1.96-, 7.02, 1.97-, 1.52-, 2.14-, 4.04-, and 2.75-fold, respectively (Fig. 5 A, C–J), and downregulated hsa-miR-381-3p by 37.9% (Fig. 5 B) compared to untreated siCtl-transfected THP-1 macrophages. However, when THP-1 macrophages were transfected with si-hsa_circ_0099188#1, MDI-GSH treatment did not induce the expression of hsa_circ_0099188, PPP3CA, KLF4, NOS2, CD206, TGM2, CCL17, CCL22, or CCL24 mRNAs (Fig. 5A, C–J). These results suggest that hsa_circ_0099188 plays a role in regulating NOS2 expression through calcineurin/NFAT signaling pathways activation via PPP3CA and the expression of the M2 macrophage-associated transcription factor KLF4, as well as the markers CD206, TGM2, and the chemokines CCL17, CCL22, and CCL24, following exposure of macrophages to MDI-GSH conjugates.

To explore whether hsa_circ_0099188 regulates the expression of calcineurin-NFAT signaling mediated expression of NOS2 via PPP3CA and M2 macrophage-associated markers and chemokines via KLF4, we assessed the expression of PPP3CA and NOS2 as well as the markers and chemokines KLF4, CD206, TGM2, CCL17, CCL22, and CCL24 transcripts in an in vitro overexpression model of hsa_circ_0099188 in THP-1 macrophages. Compared to the vector-transfected differentiated/enhanced THP-1 macrophages, transfection with hsa_circ_0099188 overexpression plasmids for 48 hours resulted in a 7.01-fold increase in hsa_circ_0099188 expression (Fig. 6A) and a 2.41- and 6.33-fold increase in the mRNA levels of PPP3CA and NOS2 (Fig. 6C, E), and 2.02-, 5.26-, and 2.30-fold increase in the mRNA levels of KLF4, CD206, and TGM2, respectively (Fig. 6 D, F–G). In addition, hsa_circ_0099188 overexpression plasmid transfection led to a 69.2% reduction of endogenous hsa-miR-381-3p levels in macrophages (Fig. 6 B). Moreover, overexpression of hsa_circ_0099188 significantly upregulated the mRNA expression of the chemokines CCL17, CCL22, and CCL24 by 3.81-, 1.75-, and 1.62-fold, respectively (Figure 6 H–J). These findings suggest that exposure to MDI-GSH conjugates induces hsa_circ_0099188, which may reduce endogenous hsa-miR-381-3p levels and simultaneously enhance the transcription and expression of calcineurin-NFAT signaling mediated induction of NOS2 via PPP3CA upregulation. In addition, the M2 macrophage-associated transcription factor KLF4, as well as the markers and chemokines CD206, TGM2, CCL17, CCL22, and CCL24 transcripts can be induced by MDI-GSH conjugates induced hsa_circ_0099188 in human macrophages.

Previous studies demonstrate that exposure to MDI-GSH conjugates induces chemotactic activity in both naïve T-cells and eosinophils (Lin et al. 2021; 2023). In addition, we found that the KLF4 transcription factor plays a critical role in regulating the expression of M2 macrophage-associated chemokines (CCL17, CCL22, and CCL24) following MDI-GSH exposure, and that MDI-GSH exposure increases the levels of hsa_circ_0099188, KLF4, CCL17, CCL22, and CCL24 transcripts (Figure 5). Since these chemokines are involved in the recruitment of T-cells, eosinophils, and other immune cells, we hypothesize that endogenous hsa_circ_0099188 may regulate T-cell and/or eosinophil chemotaxis in macrophages exposed to MDI-GSH by enhancing the secretion of CCL17, CCL22, and CCL24 proteins -- similar to previous findings that hsa_circ_0008726 regulates CCL17, CCL22, and CCL24 transcripts through targeting the hsa-miR-206-3p/KLF4 regulatory axis (Lin et al. 2024b). To test this hypothesis, we first assessed the protein levels of CCL17, CCL22, and CCL24 in the conditioned media from macrophages transfected with the hsa_circ_0099188 overexpression plasmid. The overexpression of hsa_circ_0099188 significantly increased the secretion of CCL17, CCL22, and CCL24 proteins by 10.01-, 5.03-, and 2.26-fold, respectively, compared to the vector-transfected THP-1 macrophages (Fig. 7 A–C). Next, we performed chemotaxis/migration assays using conditioned media from these macrophages. Compared to the conditioned media from vector-transfected THP-1 macrophages, media from hsa_circ_0099188 overexpressing macrophages promoted T-cell (Jurkat_E6-1 cells) migration by 1.57-fold (Fig. 7 D) and eosinophil (butyric acid-differentiated HL-60_C15 cells) migration by 2.04-fold (Fig. 7 E). These results suggest that MDI-GSH-induced hsa_circ_0099188 plays a key role in regulating macrophage-mediated chemotaxis and migration of T-cells and eosinophils.