Emerg Infect DisEmerging Infect. DisEIDEmerging Infectious Diseases1080-60401080-6059Centers for Disease Control and Prevention25271771419316814-017510.3201/eid2010.140175DispatchDispatchRickettsia parkeri and Rickettsia montanensis, Kentucky and Tennessee, USARickettsia parkeri and Rickettsia montanensis, Kentucky and Tennessee, USAR. parkeri and R. montanensis, USAPagacBenedict B.MillerMelissa K.MazzeiMeagan C.NielsenDavid H.JiangJuRichardsAllen L.US Army Public Health Command Region North, Fort George G. Meade, Maryland, USA (B.B. Pagac, M.K. Miller, M.C. Mazzei, D.H. Nielsen); Naval Medical Research Center, Silver Spring, Maryland, USA (J. Jiang, A.L. Richards)Address for correspondence: Benedict B. Pagac, Army Public Health Command–North, Entomological Sciences Branch, USPHCR-N, ESB Bldg 4411, 4411 Llewellyn Ave, Fort Meade, MD 20755-5225, USA; email: benedict.pagac.civ@mail.mil102014201017501752

We found that 14.3% (15/105) of Amblyomma maculatum and 3.3% (10/299) of Dermacentor variabilis ticks collected at 3 high-use military training sites in west-central Kentucky and northern Tennessee, USA, were infected with Rickettsia parkeri and Rickettsia montanensis, respectively. These findings warrant regional increased public health awareness for rickettsial pathogens and disease.

Keywords: Amblyomma maculatumDermacentor variabilisticksRickettsia parkeriRickettsia montanensisrickettsiabacteriamilitary training sitesKentuckyTennessee

The Gulf Coast tick (Amblyomma maculatum) has become well-established in states outside its historically described coastal range, most recently in North Carolina and Virginia (1,2). This tick has been sporadically reported in other states, including Tennessee and Kentucky (3,4). A. maculatum ticks are the recognized vector of Rickettsia parkeri, a spotted fever group (SFG) bacterium that is pathogenic to humans and has caused illness in ≥32 patients (57; C. Paddock, unpub. data).

R. parkeri–infected A. maculatum ticks from Kentucky were among specimens submitted to the human tick–testing program of the US Army during 2000–2009 (4), which increased concern of a potential health threat to military personnel using field training areas. To assess the threat of human exposure to R. parkeri and other potential rickettsial pathogens, we conducted a tick survey at 3 high-use military training sites in west-central Kentucky and northern Tennessee, USA.

The Study

Questing ticks were collected during July 16–20, 2012, by using cloth drags, flags, and CO2-baited traps, and by removing ticks from collectors (Table 1). Sites of collection were Fort Campbell (Christian County, Kentucky, and Montgomery County, Tennessee), Fort Knox (Bullitt, Hardin, and Meade Counties, Kentucky), and Wendell H. Ford Regional Training Center (WHFRTC; Muhlenberg County, Kentucky).

Quantitative PCR results for rickettsia in <italic>Amblyomma maculatum</italic> and <italic>Dermacentor variabilis</italic> ticks, Kentucky and Tennessee, USA, 2012
Location, tick species
No.
No. (%) positive for Rickettsia parkeri
No. (%) positive for R. montanenesis
Fort Knox, Kentucky
A. maculatum300
D. variabilis4402 (5)
Fort Campbell, Kentucky and Tennessee
A. maculatum6610 (15)0
D. variabilis14806 (4)
Wendell Ford Regional Training Center, Kentucky
A. maculatum365 (14)0
D. variabilis10702 (2)
Total
A. maculatum10515 (14)0
D. variablilis299010 (3)

Multiple 2-person teams collected ticks during 15-minute periods; an average of 19 person-hours was spent sampling at each site. Target tick species were A. maculatum and Dermacentor variabilis, although A. americanum ticks were also collected. Human encounter rates (calculated by using all collection methods except CO2-baited traps) for adult A. maculatum and D. variabilis ticks were ≈2 ticks/hour and 5 ticks/hour, respectively. No immature stages of these species were encountered. Field sites sampled were dominated by sericea (Lespedeza cuneata) and fescue (Festuca pratensis). Some adjacent areas had switchgrass (Panicum virgatum) and Indiangrass (Sorghastrum nutans). A. maculatum ticks appeared tolerant of exposed, unshaded sites and were often collected in the middle of these fields.

Ticks were identified by using the key of Keirans and Litwak (8). Specimens were individually placed in microcentrifuge tubes containing 500 μL of tissue lysis buffer (QIAGEN, Valencia, CA, USA) and 20 μL of proteinase K (QIAGEN), bisected with a sterile blade, and incubated at 56°C for ≥1 h. Nucleic acid was extracted by using the DNeasy Blood and Tissue Kit (QIAGEN).

Initial quantitative real-time PCRs (qPCRs) were performed by using the Rickettsia-specific Rick17b assay specific for the 17-kD antigen gene (4) and the LightCycler TaqMan Master (Roche Applied Sciences, Indianapolis, IN, USA) ready-to-use hot start reaction mixture in the LightCycler 2.0 instrument (Roche Applied Sciences). Final reactions contained 5 μL of template and 15 μL of master mixture. Master mixture contained 0.5 µmol/L primers, 0.4 μmol/L probe, LightCycler TaqMan Reaction Mixture (Roche Applied Sciences), and water. All qPCRs were performed at 95°C for 10 min and for 45 cycles at 95°C for 15 s and 60°C for 30 s.

Positive samples were further evaluated by using the SFG Rickettsia-specific conventional PCR with primer pair Rr190.70p and Rr190.602n, which is specific for the outer membrane protein A (ompA) gene of Rickettsia spp. and speciated by using PstI restriction fragment length polymorphism analysis (9). Identities of 9 positive samples were confirmed by sequencing a fragment of ompA (1,651 bp) or ompB (1,540 bp) genes (Table 2) (10). All A. maculatum tick samples positive for Rickettsia spp. were also tested for Candidatus Rickettsia andeanae by using the Rande qPCR (4).

Primers used for PCR, nested PCR, and sequencing for <italic>Rickettsia parkeri</italic> and <italic>Rickettsia montanensis</italic>, Kentucky and Tennessee, USA, 2012*
Gene, primerSequence (5′→3′)Fragment, bp
ompB
120-M59CCGCAGGGTTGGTAACTGC
ompB1570RTCGCCGGTAATTRTAGCACTPCR: 1,540
120–607FAATATCGCTGACGGTCAAGGT
120–807RCCTTTTAGATTACCGCCTAA
ompA
190–3588FAACAGTGAATGTAGGAGCAG
RompA3182RTTGCTGAGCGAAAYACTTACTYCPCR: 3,202
190–5238RACTATTAAAGGCTAGGCTATTNested PCR: 1,651
RhoA4336FAGTTCAGGAAACGACCGTA
RompA4433RTTTCCTGCAGTTACAGAATTTAAT

*omp, outer membrane protein.

A total of 404 adult ticks (105 A. maculatum and 299 D. variabilis) were collected and tested. Of these ticks, 3 A. maculatum and 44 D. variabilis ticks were collected from Fort Knox, 66 A. maculatum and 148 D. variabilis ticks were collected from Fort Campbell, and 36 A. maculatum and 107 D. variabilis ticks were collected from WHFRTC. Twenty-five (6.2%) of 404 ticks were infected with an SFG Rickettsia species. R. parkeri was detected in 15 (14.3%) of the A. maculatum ticks.

The ompA sequences (GenBank accession no. KJ741849) of A. maculatum ticks collected from Fort Campbell (n = 2) and WHFRTC (n = 2) were identical to those of R. parkeri strain Portsmouth (GenBank accession no. CP003341) and R. parkeri Maculatum 20 (GenBank accession no. U83449). R. montanensis was detected in 10 (3.3%) of the D. variabilis ticks; isolates from 5 tick samples were sequenced. The ompA sequences (GenBank accession no. KJ741850) of D. variabilis ticks from Fort Knox (n = 1) and WHFRTC (n = 2) were 99.9% identical with R. montanensis str. OSU 85–930 (GenBank accession no. CP003340). The ompB sequences (GenBank accession no. KJ741851) of 2 D. variabilis ticks collected at Fort Campbell were 99.9% identical with those of R. montanensis str. OSU 85–930 (GenBank accession no. CP003340). No other Rickettsia spp., including R. rickettsii, were detected in any of the 404 ticks tested. The greatest percentage (15%) of R. parkeri–positive A. maculatum ticks were from Fort Campbell. R. parkeri was not detected in any of the A. maculatum ticks from Fort Knox.

Conclusions

Given that A. maculatum ticks were collected at multiple sites during multiple years, and that these ticks have recently been collected in large numbers, this species is probably established in west-central Kentucky and northern Tennessee. To further elucidate its distribution, efforts should be made to collect immature stages of A. maculatum ticks from hosts, particularly birds, throughout both states.

The etiologic agent of Rocky Mountain spotted fever (RMSF), R. rickettsii, was not found in any of the ticks analyzed during this study, a finding that is consistent with findings of Fritzen et al. (11). However, during 2008–2012, a total of 15 human RMSF cases (5-year average rate of 0.1 cases/100,000 population) were reported to the Kentucky Department of Public Health (12). Likewise, for the same period, 1,695 cases of RMSF were reported to the Tennessee Department of Health (5-year average of 393 cases/100,000 population) (13). In addition, an R. parkeri human infection in Kentucky has been confirmed by PCR analysis of a tissue biopsy specimen from a patient (5). Thus, persons in west-central Kentucky and northern Tennessee may be more likely to become infected with a rickettsial agent other than R. rickettsii.

The tick encounter rates during this study suggest that persons entering appropriate habitats, especially for an extended period, are likely to encounter D. variabilis and A. maculatum ticks in west-central Kentucky and northern Tennessee during mid-summer. This study further suggests that although a person is ≈2.5 times more likely to encounter D. variabilis ticks than A. maculatum ticks, persons are ≈4.5 times more likely to encounter an R. parkeri–positive A. maculatum tick than a rickettsia-positive D. variabilis tick. These results are consistent with those of Stromdahl et al. (14).

Further evidence is needed to confirm if R. montanensis in D. variabilis ticks is of medical concern, but there has been 1 report of tick-borne R. montanensis infection associated with a nonfebrile episode in a person with a rash (15). Because of the lack of awareness regarding R. montanensis infection, it is plausible that a rash could be misdiagnosed and assumed to be a sign of a different illness. Even if an illness was recognized as a vectorborne disease, rickettsial serologic assays are not able to distinguish 1 species of SFG rickettsia from another (14). This finding indicates that serologic reactivity caused by exposure to R. montanensis could be attributed to the wrong SFG rickettsiae. Other epidemiologic studies are needed to elucidate how these findings may relate to regional rickettsial illness, but they still confirm that A. maculatum ticks infected with R. parkeri and D. variabilis ticks infected with R. montanensis warrant increased public health awareness in this region.

Suggested citation for this article: Pagac BB, Miller MK, Mazzei MC, Nielsen DH, Jiang J, Richards AL. Rickettsia parkeri and Rickettsia montanensis, Kentucky and Tennessee, USA. Emerg Infect Dis [Internet]. 2014 Oct [date cited]. http://dx.doi.org/10.3201/eid2010.140175

Acknowledgments

We thank Jesse Huff, Nita Hackwell, Rosanne Radavich, Michael Desena, Walter Roachell, and Michael Brandenburg for helping with tick collection, and Christopher Paddock for reviewing and providing critical input for this manuscript.

This study was supported in part by the US Armed Forces Health Surveillance Center work unit #0000188M.0931.001.A0074.

Mr Pagac is an entomologist at the US Army Public Health Command Region-North, Fort Meade, Maryland. His research interests focus on reducing the threat of vector-borne diseases to personnel at military installations in the northeastern United States.

ReferencesVarela-Stokes AS, Paddock CD, Engber B, Toliver M. Rickettsia parkeri in Amblyomma maculatum ticks, North Carolina, USA, 2009–2010. Emerg Infect Dis. 2011;17:23503 10.3201/eid1712.11078922172164Wright CL, Nadolny RM, Jiang J, Richards AL, Sonenshine DE, Gaff HD, Rickettsia parkeri in Gulf Coast ticks, southeastern Virginia, USA. Emerg Infect Dis. 2011;17:8968 10.3201/eid1705.10183621529406Cohen SB, Yabsley MJ, Garrison LE, Freye JD, Dunlap BG, Dunn JR, Rickettsia parkeri in Amblyomma americanum ticks, Tennessee and Georgia, USA. Emerg Infect Dis. 2009;15:14713 10.3201/eid1509.09033019788817Jiang J, Stromdahl EY, Richards AL. Detection of Rickettsia parkeri and Candidatus Rickettsia andeanae in Amblyomma maculatum Gulf Coast ticks collected from humans in the United States. Vector Borne Zoonotic Dis. 2012;12:17582 10.1089/vbz.2011.061422022815Paddock CD, Finley RW, Wright CS, Robinson HN, Schrodt BJ, Lane CC, Rickettsia parkeri rickettsiosis and its clinical distinction from Rocky Mountain spotted fever. Clin Infect Dis. 2008;47:118896 10.1086/59225418808353Cragun WC, Bartlett BL, Ellis MW, Hoover AZ, Tyring SK, Mendoza N, The expanding spectrum of eschar-associated rickettsioses in the United States. Arch Dermatol. 2010;146:6418 10.1001/archdermatol.2010.4820404224Myers T, Lalani T, Dent M, Jiang J, Daly PL, Maguire JD, Detecting Rickettsia parkeri infection from eschar swab specimens: a novel diagnostic approach for a rare condition. Emerg Infect Dis. 2013;19:77880 10.3201/eid1905.12062223647926Keirans JE, Litwak TR. Pictoral key to the adults of hard ticks, family Ixodidae (Ixodia: Ixodoidae), east of the Mississippi River. J Med Entomol. 1989;26:43548 .2795615Eremeeva M, Yu X, Raoult D. Differentiation among spotted fever group rickettsiae species by analysis of restriction fragment length polymorphism of PCR-amplified DNA. J Clin Microbiol. 1994;32:803107910831Jiang J, Maina AN, Knobel DL, Cleaveland S, Laudisoit A, Wamburu K, Molecular detection of Rickettsia felis and Candidatus Rickettsia asemboensis in fleas from human habitats, Asembo, Kenya. Vector Borne Zoonotic Dis. 2013;13:5508 10.1089/vbz.2012.112323675818Fritzen CM, Huanh J, Westby K, Freye JD, Dunlap B, Yabsley MJ, Infection prevalences of common tick-borne pathogens in adult lone star ticks (Amblyomma americanum) and American dog tick (Dermacentor variabilis) in Kentucky. Am J Trop Med Hyg. 2011;85:71823 10.4269/ajtmh.2011.10-058321976578Kentucky Department for Public Health. Kentucky reportable diseases 5-year summary 2008–2012, Kentucky, USA, August 7, 2013 [cited 2013 Nov 26]. http://chfs.ky.gov/dph/epi/rd5yr.htmTennessee Department of Health. Communicable disease interactive data RMSF 2008–2012 results, Tennessee, USA, 2012 [cited 2013 Nov 7]. http://health.tn.gov/Ceds/WebAim/Reports/ResultStromdahl EY, Jiang J, Vince M, Richards AL. Infrequency of Rickettsia rickettsii in Dermacentor variabilis removed from humans, with comments on the role of other human-biting ticks associated with spotted fever group rickettsiae in the United States. Vector Borne Zoonotic Dis. 2011;11:96977 10.1089/vbz.2010.009921142953McQuiston JH, Zemtsova G, Perniciaro J, Hutson M, Singleton J, Nicholson WL, Afebrile spotted fever group Rickettsia infection after bite from a Dermacentor variabilis tick infected with Rickettsia montanensis. Vector Borne Zoonotic Dis. 2012;12:105961 10.1089/vbz.2012.107823153005