The OROV strains used in this study (Table A1) were relatively low-passage isolates obtained from the virus collection of the Department of Arbovirology and Hemorrhagic Fevers, Evandro Chagas Institute (Ananindeua, Brazil). These strains corresponded to viruses recovered from different hosts and geographic locations that were isolated during 1960–2009.

Viruses were propagated in monolayer cultures of Vero cells. After 75% of cells showed cytopathic effects, the supernatants of infected cell cultures were collected. RNA extraction was conducted by using a commercial kit (QIAmp Viral RNA Mini Kit; QIAGEN, Valencia, CA, USA) according to the manufacturer’s instructions.

For the synthesis and amplification of the OROV small RNA, medium RNA, and large RNA cDNA (cDNA), a 1-step reverse transcription–PCR (RT-PCR) was conducted by using a combination of specific-segment sets of the following primers: small RNA (NORO5: AAAGAGGATCCAATAATGTCAGAGTTCATTT; ORO N3: GTGAATTCCACTATATGCCAATTCCGAATT), medium RNA (Gn15S: GGCAACAAACAGTGACAAT and Gn659R: CTATGTTAACGCACATTGCT), and large RNA (LOROF: CCGAAACAAACAAAAACAAT; and large RNA (LOROF: CCGAAACAAACAAAAACAAT and LOROR: GGATGAGTAAGCAATTCTGG) (7). Amplicon lengths were expected to be 693 bp, 644 bp, and 634 bp for small RNA, medium RNA, and large RNA, respectively. The RT-PCR products were visualized onto 1.2% agarose gel stained with ethidium bromide (0.5 μg/mL). Amplicons were sequenced by using the same primers applied for the RT-PCR cycling and the ABI PRISM Dye Terminator Kit (Applied Biosystems, Foster City, CA, USA) by using the dideoxyribonucleotide chain terminator method (11). The ABI 3130 capillary automated sequencer (Applied Biosystems) was used to obtain the sequence. Both cDNA strands were sequenced from at least 3 RT-PCR products.

Sequences obtained for the N (complete), Gn, and large (partial) genes were first inspected in quality by the SeqMan LaserGene package (DNA STAR, Madison, WI, USA) and then used for multiple sequencing alignments with other OROV sequences available in GenBank (www.ncbi.nlm.nih.gov/genbank). The genetic divergence for each gene was determined by using MEGA4 software (12) based on the dataset generated by the alignments. Confidence interval for inclusion into a given phylogenetic group was estimated according to the mean of genetic divergence calculated for the known OROV genotypes (I, II, and III) and used as a criterion for searching other genotype groups.

The phylogenetic analysis was performed by comparing the 66 entire N genes and 36 partial Gn genes and large sequences of Brazilian OROV strains, respectively, with homologous sequences obtained from other OROVs isolated from different regions of Central and South America, periods of time, and source of isolation (Table 1). Phylogenetic trees were constructed by using the neighbor-joining (13), maximum-likelihood, and maximum-parsimony methods in the PAUP 4.0 software (14) as described (8). Bayesian and time-scaled (chronologic) analyses also were conducted as described by Rodrigues et al. (15). Sequences obtained from the OROV isolates were deposited in GenBank (Table, GenBank accession numbers of previously sequenced OROV and other Simbu group virus strains; Table A1).

To evaluate the topologies presented by the different RNA segments, we used 36 OROV strains for which all 3 segments were sequenced. The evaluation was performed by using the Kishino-Hasegawa method (16), comparing a topology generated for a given RNA segment with the other segments. We considered p values <0.01 significant.

The nucleotide sequences obtained for the studied strains were 693 nt (231 aa), 644 nt (214 aa), and 634 nt (211 aa) in length for N, Gn, and large genes, respectively. The multiple sequencing analysis of the new 66 full-length OROV N (small RNA) and for the 36 partial Gn (medium RNA) and large RNA gene sequences showed high nucleotide and amino acid identities (>90%). The mean of genetic divergence among the N gene nucleotide sequence was ≈6.8%. Genetic distances (nucleotide sequence) within the 3 well-established genotypes (I, II, and III) ranged from 3% between genotypes I and II to 4.4% between genotypes I and III (mean 3.5%) and were used as a confidence value for inclusion within a given genotype. On the basis of this criterion, a fourth group was established, and a genetic divergence ranging from 5.3% with genotype I to 6.8% with genotype III (mean 5.8%) was determined. The mean of genetic divergence among the 4 OROV lineages was 4.6% (Table 1).

Regarding the Gn gene nucleotide sequences, the analysis showed values of genetic divergence of 0.9%–9.5% (mean 6.5%). In contrast to the N gene sequences, for the Gn gene partial sequences, 3 lineages were identified, showing an intergroup divergence of 4.5% (between groups I and II) to 7.2% (between groups I and III) (mean 5.7%), which was used as a confidence value for group inclusion or exclusion (Table 1).

For the polymerase gene nucleotide sequences (large RNA), genetic divergence was 0.1%–0.8% (mean 0.5%). Only 2 large RNA segments were distinguished into groups (Table 1).

Regardless of the method used, the trees were similar in topology, showing high support values (bootstrap, likelihood, or posterior probability values). The Bayesian method showed high support values (>0.90) and was therefore used to represent the final tree. As previously reported (7–10), the comparative phylogeny that used the entire N gene sequences (96 strains; Table A1) confirmed the monophyletic origin of OROV in comparison with other Simbu group viruses (Figure 1),

The 4 major phylogenetic groups depicted (I–IV) corresponded to 4 distinct genotypes (Figure 2 [Bayesian method]). Genotype I included the Brazilian strains isolated in the states of Acre, Amazonas, Maranhão, Tocantins, and Pará, as well as strains from Trinidad and Tobago. Three subgenotypes were described: Ia, Ib, and Ic (Figure 1). Genotype II grouped strains obtained during outbreaks in the states of Amapá, Pará, and Rondônia in Brazil and the strains from Peru. Three subgenotypes also were assigned to this group (II a, II b, and II c). Genotype III was formed by strains isolated in the Brazilian states of Acre, Minas Gerais, and Rondônia, and the isolates from Panama showing 2 distinct sublineages: the subgenotypes II a and III b. Finally, genotype IV included the Brazilian strains isolated in Amazonas State, Brazil (Figure 2).

Chronologic analysis was used to investigate the emergence period of OROV in the Americas. The nucleotide substitution rate that determined the 96 OROV N gene sequences was 3.7 × 10^–4 substitutions per site per year and was used to estimate the divergence dates among the strains. The emergence of the most recent common ancestor (MRCA) for OROV in the Americas was estimated to have occurred ≈223 years ago (95% highest probability density [HPD] 148–342 years) from the location where the other parental viruses for the different genotypes (I, II, III, and IV) emerged (Figure 2). The estimated emergence dates suggest that genotype I was the first genotype that emerged ≈112 years ago (95% HPD 95–189 years). Genotype II emerged ≈91 years ago (95% HPD 59–144 years) and originated from strains isolated in the states of Pará and Rondônia, and strains recently isolated in Amapá State, in 2009. Genotype III was estimated to have originated 37 years ago (95% HPD 33–70 years) and probably evolved in Rondônia State 33 years ago (95% HPD 29–58 years), and other Amazonian states, such as Acre and Pará, emerging almost simultaneously in Panama 32 years ago (95% HPD 22–45 years) and, more recently, in Minas Gerais State. Genotype IV emerged in Amazonas State ≈43 years ago (95% HPD 31–56 years; Figure 2).

Trees generated from entire N and partial Gn and large gene sequences obtained for 36 OROV strains demonstrated different topologies. By using all phylogenetic methods, we found differences in virus clustering. For the small RNA, 4 distinct groups were identified: group I (20 strains), group II (9 strains), group III (5 strains), and group IV (2 strains). For the medium RNA, 3 groups were assigned and distributed as follows: group I (28 strains), group II (4 strains), and group III (4 strains). The large RNA depicted only 2 major groups, including 32 strains in group I and 4 strains in group II (Figure 3). Maximum likelihood was used to analyze these competing small, medium, and large segment topologies by using the Kishino-Hasegawa test. Sequence evolution models were optimized by applying all genome segments and using the competing topologies. Regardless of which model was selected, each topology generated by using maximum parsimony and neighbor-joining methods with a given genome segment was significantly more likely than the competing topology generated by using the other genome segment (likelihood probability between S and M topologies = 0.00005623; likelihood probability between S and L topologies = 0.000354664; likelihood probability between M and L topologies = 0.00043154; p<0.001).

On the basis of results obtained for the N gene data by time-scaled analysis (evolutionary rate and emergence date) and epidemiologic data association (date and place of isolation), the possible dispersal event could be predicted for the distinct OROV genotypes in the Americas (Figure 4). Genotype I (dispersion route in red), originally isolated in Brazil in the municipality of Ipixuna, Pará State (BR 010 Highway, km 94), possibly dispersed continuously toward distinct directions: initially to several municipalities in western Pará, and simultaneously in Trinidad and Tobago. Later, genotype I moved toward the states of Amazonas and Acre and, more recently, to the eastern Amazon region including Pará, Maranhão, and Tocantins States. Genotype II (dispersion route in dark blue), apparently emerged simultaneously in the states of Amapá, Pará, and Rondônia, as well as in Peru, and dispersed in these places, emerging in the municipality of Mazagão, Amapá State, in 2009. Genotype III (dispersion route in green), emerged in Rondônia State, moving toward Panama and the states of Acre and Maranhão. From Maranhão, a new route led genotype III to the Minas Gerais State. Genotype IV (black dot in Manaus), apparently more ancient than genotype III, emerged in the city of Manaus, Amazonas State, and it has not apparently dispersed from there (Figure 4).