An encephalitis outbreak among horses was caused by a pathogenic variant of Kunjin virus.
To determine the cause of an unprecedented outbreak of encephalitis among horses in New South Wales, Australia, in 2011, we performed genomic sequencing of viruses isolated from affected horses and mosquitoes. Results showed that most of the cases were caused by a variant West Nile virus (WNV) strain, WNVNSW2011, that is most closely related to WNV Kunjin (WNVKUN), the indigenous WNV strain in Australia. Studies in mouse models for WNV pathogenesis showed that WNVNSW2011 is substantially more neuroinvasive than the prototype WNVKUN strain. In WNVNSW2011, this apparent increase in virulence over that of the prototype strain correlated with at least 2 known markers of WNV virulence that are not found in WNVKUN. Additional studies are needed to determine the relationship of the WNVNSW2011 strain to currently and previously circulating WNVKUN strains and to confirm the cause of the increased virulence of this emerging WNV strain.
In Australia, Murray Valley encephalitis virus (MVEV) and West Nile virus (WNV) Kunjin (KUN) strain are the main etiologic agents of arboviral encephalitis in humans, which usually occurs as isolated sporadic cases or occasional small outbreaks, mainly in northwestern Australia and rarely in southern regions (
Known distribution of West Nile virus infection and disease caused by Kunjin strain (A) and distribution of encephalitis cases among equids (B), New South Wales, Australia, 2011. Dashed line indicates the Great Dividing Range.
In 2011, an outbreak of encephalitis occurred among horses in NSW. To analyze this strain of WNVKUN, we conducted genomic sequencing, antigenic profiling, in vitro growth kinetics, and mouse virulence studies on virus isolates from diseased animals and mosquitoes.
In late February 2011, neurologic disease was reported in several horses in northwestern and southwestern NSW. The number of cases and geographic distribution gradually increased. By mid-June 2011, specimens from ≈300 horses were submitted to the virology laboratory at Elizabeth Macarthur Agriculture Institute (Menangle, NSW, Australia). Many more horses probably were affected. Diseased horses were located throughout most of NSW, west of the Great Dividing Range, but also extending through the Hunter River Valley region, Sydney Basin, and Illawarra coastal region immediately south of Sydney (
Whole brains were removed from 12 horses at postmortem examination. Half of each brain was fixed in 10% neutral buffered formalin; the other half was held fresh at 4°C. Upon receipt, we collected small pieces of fresh and formalin-fixed tissue from several locations in the cerebrum and cerebellum and along the brain stem and cervical spinal cord. If virus isolation could not be performed on fresh samples within 24 h after receipt, we held the samples at −80°C until tested. Before testing, we prepared 10% tissue homogenates in RPMI medium (Life Technologies, Carlsbad, CA, USA) containing antimicrobial drugs.
Mosquitoes were collected throughout NSW, as part of the NSW Arbovirus Surveillance and Mosquito Monitoring Program, by using dry ice–baited light traps. The mosquitoes were submitted live to the Medical Entomology Laboratory at Westmead Hospital (Westmead, NSW, Australia) for species identification, arbovirus isolation, and virus identification (
We propagated Vero 76 cells in Dulbecco modified minimum essential medium (DMEM; Life Technologies) supplemented with 10% fetal bovine serum (FBS). C6/36
We conducted microneutralization tests (
We used the MagMax-96 Viral RNA Isolation Kit (Ambion, Austin, TX, USA) on a magnetic particle handling system (Kingfisher 96; Thermo Electron Corporation, Vantaa, Finland) to extract total nucleic acid from clarified 10% brain homogenate (50 μL) or tissue culture fluid. Purified nucleic acids were eluted in 50 μL of kit elution buffer and used immediately for PCR amplification or stored frozen at ≈−20°C
We used a published WNV real-time reverse transcription PCR (rRT-PCR) (
Supernatant from the 10% brain homogenate was placed on monolayers of
WNVNSW2011 virus harvested from the first passage in C6/36 cells was used to examine plaque morphology and virulence in mice. The virus was passaged 1× in Vero76 cells for 4 d and 1× in C6/36 cells for 5 d. Virus supernatant was centrifuged at 500 ×
Reactivity of the new isolate with a panel of mAbs was compared with that of WNVKUN and WNVNY99 by using a fixed-cell ELISA (
For sequencing of the whole genome, we used total nucleic acid purified from virus-infected cell culture supernatant as template in 5 RT-PCRs with primers designed to cover the coding regions of any WNV genome (
| RT-PCR region | Forward primer, 5′ → 3′ (relative genome position†) | Reverse primer, 5′ → 3′ (relative genome position†) |
|---|---|---|
| Amplification and sequencing of whole genome | ||
| 5′ NTR capsid | TAGTTCGCCTGTGTGAGCTG (5′ NTR-2) | TTGAAAATTCCACAGGAATGG (capsid-1772) |
| Capsid-NS2A | GTGATAGCATTGGGCTCWCA (capsid-1720) | ATCTTGAAGGYYGCCATGAG (NS2A-1760) |
| NS2A-NS3 | CACTGATGTGTTACGCTATGTCA (NS2A-3678) | CAAAGTCCCAATCATCGTTCT (NS3-5807) |
| NS3-NS5 | CGGTTTGGTTTGTGCCTAGT (NS3-5687) | CCAACTTCACGCAGGATGTA (NS5-9235) |
| NS5–3′ NTR | GACCACTGGCTTGGAAGAAA (NS5-9169) | CTGGTTGTGCAGAGCAGAAG (3′ NTR-10955) |
| Partial sequencing of key regions of genome | ||
| NS3 | GTGCTGGTAAAACAAGGAGG (NS3-5201) | TGTATCCTCTAGCCGCGATG (NS3-5493) |
| NS5 | TCGGCCCAGATGATGTG (NS5-9575) | CGGCATGGAACCACCAGTGTTC (NS5-9860) |
*Primers were designed from available sequences in GenBank to cover the coding regions of any WNV genome. WNV, West Nile virus; RT, reverse transcription; NTR, nontranslated region; NS, nonstructural protein. †WNVNY99 GenBank accession no. NC_009942.1.
Complete coding regions of selected WNV isolates, representing all lineages and clades and including all complete KUN sequences, were aligned with the WNVNSW2011 sequence as described (
To examine glycosylation of the E protein, viral proteins from cultures of infected C6/36 cells were digested as described (
We allowed the virus to adsorb to monolayers of Vero 76 cells in 6-well plates for 2 h at 37°C. The cells were overlaid with DMEM containing 0.75% low melting point agarose and 2% FBS. Four days after infection, the cells were fixed with 4% formaldehyde solution and stained with 0.2% crystal violet.
Groups of 10 weanling (18–19 days old) or young adult (4 weeks old) Swiss outbred CD1 mice were injected intraperitoneally with 10-fold dilutions of virus. The mice were monitored for 21 days after injection and euthanized when signs of encephalitis were evident. All animal procedures had received prior approval from The University of Queensland Animal Ethics Committee.
Viral RNA was detected by WNV-specific rRT-PCR in fresh brain tissue from 6 of 12 horses showing signs of encephalitis. Viruses were isolated from 4 of these samples; each showed distinct cytopathology in BHK21 and Vero cells. rRT-PCR of the culture fluids and immunoperoxidase staining of the cells with pan–flavivirus-reactive and WNV-specific mAbs confirmed the isolation of a West Nile–like virus. The first isolate was named NSW2011 and designated WNVNSW2011. Eight isolates of WNVNSW2011 were isolated from
To antigenically type WNVNSW2011 in a fixed-cell ELISA (
| Virus | Monoclonal antibody, by specificity | |||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Pan-flavivirus† | WNV group | WNVKUN | Unglycosylated WNV E protein | Glycosylated WNV E protein | MVEV | |||||||||
| 4G4, anti-NS1 | 4G2, anti-E | 2B2, anti-E | 3.91D, anti-E | 10A1, anti-E | 5H1, anti-NS5 | 10C6, anti-NS1 | ||||||||
| 3.101C | 17D7 | |||||||||||||
| WNVNSW2011 | + | + | + | + | + | − | − | + | − | |||||
| WNVKUN† | + | + | + | + | + | + | + | − | − | |||||
| WNVNY99‡ | + | + | + | + | − | − | − | + | − | |||||
*WNV, West Nile virus; KUN, Kunjin; E, envelope; MVEV, Murray Valley encephalitis virus; NS, nonstructural protein; NS, nonstructural protein; NSW, New South Wales; + positive; –, negative; NY, New York. †Prototype WNVKUN strain MRM-61C. ‡North American WNV strain.
To assess the level of antigenic crossreactivity between WNVNSW2011, WNVKUN, and WNVNY99, we assessed neutralization titers for homologous and heterologous viruses in immune serum samples from the following sources: horses infected during the 2011 outbreak, horses infected with WNVKUN in the Northern Territory of Australia several years earlier, and horses infected with WNV in the United States. Convalescent-phase serum samples from WNVNSW2011-immune horses had neutralizing titers similar to those of the homologous virus (WNVNSW2011) and of WNVKUN and WNVNY99 (
| Horse serum samples | % Inhibition of CPE/growth† | |||||||
|---|---|---|---|---|---|---|---|---|
| WNVNSW2011, 100 infectious units | WNVKUN, 26 infectious units | WNVNY99, 32 infectious units | ||||||
| 80‡ | 100§ | 80 | 100 | 80 | 100 | |||
| Control¶ | ||||||||
| 1 | <20 | <20 | <20 | <20 | <20 | <20 | ||
| 2 | <20 | <20 | <20 | <20 | <20 | <20 | ||
| 3 | <20 | <20 | <20 | <20 | <20 | <20 | ||
| 4 | <20 | <20 | <20 | <20 | <20 | <20 | ||
| 5 | <20 | <20 | <20 | <20 | <20 | <20 | ||
| NSW# | ||||||||
| 04 | 640 | 320 | 1,280 | 1,280 | 640 | 320 | ||
| 06 | 320 | 160 | 640 | 640 | 1,280 | 160 | ||
| 08 | 320 | 320 | 1,280 | 1,280 | 640 | 640 | ||
| 28 | 320 | 320 | 640 | 640 | 320 | 320 | ||
| 36 | 320 | 160 | 640 | 640 | 320 | 640 | ||
| NT** | ||||||||
| 111473 | ||||||||
| 104714 | ||||||||
| 110910 | 80 | 40 | 160 | 160 | 160 | 160 | ||
| 98727 | 40 | 40 | 160 | 160 | 80 | 80 | ||
| WNV†† | ||||||||
| 1 | ||||||||
| 2 | ||||||||
| 3 | ||||||||
| 4 | ||||||||
| 5 | ||||||||
| mAb 3.91D‡‡ | >2,560 | >2,560 | >2,560 | >2,560 | >2,560 | >2,560 | ||
*Determined, as described (
A comparison of the nucleotide sequence of the complete coding region of the first isolate of WNVNSW2011 with sequences available in GenBank confirmed that WNVNSW2011 was genetically most closely related to Australian WNVKUN isolates (
Maximum-likelihood tree based on nucleotide sequences of the complete open reading frame of genomes of West Nile virus (WNV) NSW2011 (
The average plaque size of WNVNSW2011 (
Studies of West Nile virus (WNV) properties in cell cultures and mice. A) Plaque morphology of WNVNY99, prototype WNVKUN, and WNVNSW2011 in Vero cells. Cells in 6-well plates were infected with specified virus and overlaid with 0.75% low melting point agarose in Dulbecco modified minimum essential medium (Life Technologies, Carlsbad, CA, USA) containing 2% fetal bovine serum. Four days after infection, the cells were fixed with 4% formaldehyde and stained with 0.2% crystal violet. B) Assessment of envelope (E) protein glycosylation of WNVNSW2011, WNVKUN and WNVNY99 by endoglycosidase digestion (PNGase F; Roche Diagnostics, Basel, Switzerland). Viral proteins in culture supernatant were digested by PNGase F (+) or undigested (−) and then resolved on sodium dodecyl sulfate–polyacrylamide gel electrophoresis. The migration rate of the E protein in each sample was determined by Western blot with E glycoprotein–specific monoclonal antibodies. C) Young adult (4 weeks old) or D) weanling (18–19 days old) Swiss outbred mice survival after intraperitoneal injection with 1,000 PFU (adult) or 10 PFU (weanling) of WNVNY99, WNVKUN, or WNVNSW2011. The mice were monitored for 21 days after injection for signs of encephalitis and then euthanized. The differences in virulence in weanling and adult mice between different pairs of viruses were all highly significant, as calculated by log rank Mantel-Cox algorithm with exact p values: for adult mice, WNVNY99 vs. WNVKUN p<0.0001, WNVNY99 vs. WNVNSW2011 p = 0.0001, and WNVKUN vs. WNVNSW2011 p = 0.0012; and for weanling mice, WNVNY99 vs. WNVKUN p<0.0001, WNVNY99 vs. WNVNSW2011 p =0.0004, and WNVKUN vs. WNVNSW2011 p = 0.0006. NY, New York; KUN, Kunjin; NSW, New South Wales.
Injection of 18- to 19-day-old (weanling) mice with 10-fold dilutions of virus showed that substantially lower doses of WNVNSW2011 (50% lethal dose [LD50] 0.5 PFU), compared with WNVKUN (LD50 13.4 PFU), induced neurologic signs (
| Virus and dose, PFU | No. mice/no. died | Average survival time, d | LD50 |
|---|---|---|---|
| WNVNY99 | |||
| 100 | 10/10 | 6.1 | |
| 10 | 10/10 | 6.7 | |
| 1 | 10/10 | 6.9 | 0.1 PFU |
| 0.1 | 5/10 | 7.8 | |
| WNVKUN | |||
| 1,000 | 9/10 | 8.4 | |
| 100 | 4/10 | 8 | 13.4 PFU |
| 10 | 6/10 | 10.2 | |
| 1 | 3/10 | 12 | |
| WNVNSW2011 | |||
| 1,000 | 10/10 | 7.1 | |
| 100 | 10/10 | 7.4 | |
| 10 | 10/10 | 7.7 | 0.5 PFU |
| 1 | 7/10 | 8.3 | |
| 0.1 | 1/10 | 10 |
*WNV, West Nile virus; LD50, dose at which 50% of the mice died; NY, New York; KUN, Kunjin; NSW, New South Wales.
| Virus and dose, PFU | No. mice/no. died | Average survival time, d | LD50 |
|---|---|---|---|
| WNVNY99 | |||
| 100 | 10/10 | 8.3 | |
| 10 | 10/10 | 8.2 | 0.7 PFU |
| 1 | 5/10 | 8.6 | |
| 0.1 | 2/10 | 10 | |
| WNVKUN | |||
| 1,000 | 0/10 | 21 | >1,000 PFU |
| WNVNSW2011 | |||
| 1,000 | 7/10 | 10.7 | |
| 100 | 2/10 | 11 | 240 PFU |
| 10 | 3/10 | 10.3 |
*WNV, West Nile virus; LD50, dose at which 50% of the mice died; NY, New York; KUN, Kunjin; NSW, New South Wales.
It is estimated that at least 1,000 horses were affected during an unprecedented outbreak of encephalitis in southeastern Australia during 2011. The case-fatality rate was 10%–15%, and diseased animals had clinical signs consistent with those observed during a WNV outbreak in the United States. Not only was the Australian outbreak unique and unprecedented in size and disease severity, but its epidemiologic features also differed from those observed previously in Australia. In particular, WNVKUN now has been detected on the eastern seaboard of NSW, close to major urban areas, including the largest 3 cities (Sydney, Newcastle, and Wollongong). This detection occurred despite relatively small mosquito populations in many of these areas, suggesting that the virus is more virulent and probably transmitted more efficiently than other strains between mosquito vectors and mammalian hosts. Characterization of virus isolated from the brain of an animal that died showed a variant strain of WNV most closely related to WNVKUN. Typing of WNVNSW2011 by reactivity with a panel of mAbs indicated the virus was antigenically more similar to the native Australian WNVKUN strains than to exotic WNV strains. However, for WNVNSW2011, the reaction profile of mAbs 17D7 and 3.101C differed from that of the prototype WNVKUN. Similar to WNVNY99 and other virulent strains of WNV, WNVNSW2011 E protein was glycosylated at residue 154. This finding was further confirmed by gene sequencing and endoglycosidase F digestion analysis. Glycosylation of WNV E protein at this site is thought to enhance virus dissemination in the infected host by increasing the efficiency of assembly and release of virus particles from infected cells (
Another unusual aspect of the 2011 outbreak was the absence of encephalitis caused by WNVKUN in humans. In contrast, several confirmed cases of Murray Valley encephalitis in humans were recorded in southeastern Australia during this time. This absence of disease in humans suggests that ecologic and/or epidemiologic features of the virus transmission cycle, such as small mosquito populations and timely alerts, probably resulted in less exposure of the human population to WNVNSW2011.
The US outbreak of WNV was associated with high mortality among several bird species, particularly American crows (
Taken together, our results show that the WNVNSW2011 isolate is closely related to Australian WNVKUN strains. However, in contrast to the prototype WNVKUN strain (MRM-61C), the new virus has several amino acid substitutions that are likely to be the reason for enhanced virulence in horses. More extensive epidemiologic studies in the field and experimental studies in the laboratory are required to determine the relation of WNVNSW2011 to other currently and previously circulating WNVKUN strains and to confirm which viral proteins and amino acid residues are associated with increased virulence of WNVNSW2011 in horses.
These authors contributed equally to the major technical aspects of this research.
These authors served as joint senior authors.
We thank Steven Davis and Richard Bowen for the generous supply of horse serum and Melissa Sanchez and Robert Doms for providing mAb 17D7. We are also grateful to the veterinarians who submitted brain samples from affected horses; without these samples, this isolate would not have been available for study.
The NSW Arbovirus Surveillance and Mosquito Monitoring Program is funded by the NSW Ministry of Health. The work was also supported by the grants to A.A.K. and R.A.H. from the National Health and Medical Research Council of Australia and the Australian Research Council.
| Polyprotein and aa position in polyprotein (position in individual protein) | WNV strain (GenBank accession no.) | No. aa differences† | ||
|---|---|---|---|---|
| MRM61C AY274504.1) | NY99 4132 (HQ596519) | NSW2011 (JN887352) | ||
| C | ||||
| 28 | T | I | I | |
| 41 | R | K | R | 2(0):2(2):4(2) |
| 44 | T | I | I | |
| 71 | S | G | S | |
| PrM | ||||
| 108(3) | K | K | R | |
| 113(8) | F | V | F | |
| 114(9) | M | M | T | |
| 120(15) | G | S | G | |
| 143(38) | T | T | A | 6(5):10(7):7(3) |
| 145(40) | I | V | I | |
| 158(53) | I | I | T | |
| 166(61) | H | Y | Y | |
| 195(90) | L | S | L | |
| 228(123) | S | A | S | |
| 279(174) | A | V | T | |
| E | ||||
| 334(44) | K | K | R | |
| 357(67) | E | D | E | |
| 379(89) | S | A | S | |
| 383(93) | K | R | K | |
| 416(126) | T | I | T | |
| 446(156) | F | |||
| 449(159) | T | V | T | 3(1):15(7):14(8) |
| 452(162) | A | T | A | |
| 489(199) | S | N | S | |
| 519(229) | E | G | E | |
| 521(231) | N | T | N | |
| 600(310) | R | K | R | |
| 628(338) | I | V | I | |
| 655(365) | S | A | S | |
| 700(410) | A | T | A | |
| 773(483) | L | L | F | |
| NS1 | ||||
| 837(46) | I | I | V | |
| 879(88) | I | V | I | |
| 893(102) | R | K | R | |
| 926(135) | I | V | I | |
| 937(146) | Q | Q | R | |
| 961(170) | R | K | R | |
| 997(206) | F | L | L | 5(2):12(2):9(0) |
| 1027(236) | V | I | V | |
| 1036(245) | I | V | I | |
| 1055(264) | S | N | S | |
| 1081(290) | S | S | N | |
| 1089(298) | T | T | I | |
| 1118(327) | N | S | N | |
| NS2A | ||||
| 1255(112) | A | V | V | |
| 1262(119) | Y | H | Y | |
| 1272(129) | M | I | I | |
| 1311(168) | C | R | C | 5(0):5(2):6(2) |
| 1326(183) | I | I | V | |
| 1330(187) | I | I | M | |
| 1355(212) | F | L | F | |
| 1366(223) | V | I | I | |
| NS2B | ||||
| 1400(26) | I | I | M | |
| 1438(64) | G | S | S | 2(1):2(0):2(1) |
| 1477(103) | A | V | A | |
| 1520(15) | R | K | K | |
| 1615(110) | Q | R | Q | |
| 1680(174) | V | I | V | |
| 1754(249) | A | P | A | |
| 1809(303) | R | K | R | |
| 1836(331) | A | S | A | 3(0):12(6):11(6) |
| 1861(356) | I | T | I | |
| 1887(382) | K | K | R | |
| 1889(383) | I | V | I | |
| 1912(406) | V | I | V | |
| 1970(465) | N | N | S | |
| 1991(486) | C | F | C | |
| 2115(610) | S | A | S | |
| NS4A | ||||
| 2129(5) | F | L | F | |
| 2179(55) | A | A | T | |
| 2209(85) | V | A | V | |
| 2213(89) | A | V | A | 2(2):5(1):5(1) |
| 2265(141) | L | M | L | |
| 2269(145) | G | S | S | |
| NS4B | ||||
| 2288(15) | G | S | G | |
| 2296(23) | T | V | I | |
| 2302(29) | I | M | I | |
| 2324(50) | V | V | F | |
| 2334(60) | T | T | M | 7(4):11(5):7(3) |
| 2368(94) | A | A | S | |
| 2387(114) | S | A | S | |
| 2389(116) | T | T | A | |
| 2449(176) | V | I | V | |
| 2450(177) | M | M | I | |
| 2459(186) | L | V | L | |
| 2518(245) | V | I | I | |
| NS5 | ||||
| 2553(25) | I | T | I | |
| 2561(33) | T | I | T | |
| 2575(47) | R | G | R | |
| 2577(48) | I | V | V | |
| 2629(101) | R | R | K | |
| 2690(162) | L | I | L | |
| 2705(177) | K | R | K | 7(3):15(7):12(8) |
| 2711(183) | V | V | I | |
| 2775(247) | K | R | K | |
| 2840(311) | E | D | E | |
| 3059(531) | R | K | R | |
| 3088(560) | D | D | N | |
| 3181(653) | S | |||
| 3247(719) | T | T | I | |
| 3259(731) | T | V | T | |
| 3405(877) | S | A | S | |
| 3427(899) | L | L | F | |
| Total changes | 42(18):89(38):77(34 | |||
*WNV, West Nile virus; NY, New York; NSW, New South Wales; C, core; NS, nonstructural; PrM, precursor membrane; E, envelope. †No. aa differences (nonconservative changes in parentheses) for WNVKUN vs. WNVNSW2011:WNVNY99 vs. WNVNSW2011:WNVKUN vs. WNVNY99.
Dr Frost is a scientist engaged in research to characterize new and emerging viral pathogens among animals. She also has a special interest in the application of molecular methods for the diagnosis of viral diseases.