Emerg Infect DisEmerging Infect. DisEIDEmerging Infectious Diseases1080-60401080-6059Centers for Disease Control and Prevention22469314330968411-158310.3201/eid1804.111583Letters to the EditorLetterRickettsia monacensis as Cause of Mediterranean Spotted Fever–like Illness, ItalyMSF-like IllnessMadedduGiordanoManciniFabiolaCaddeoAntonelloCiervoAlessandraBabudieriSergioMaidaIvanaFioriMaria LauraRezzaGiovanniMuraMaria StellaUniversity of Sassari, Sassari, Italy (G. Madeddu, A. Caddeo, S. Babudieri, I. Maida, M.L. Fiori, M.S. Mura);Istituto Superiore di Sanità, Rome, Italy (F. Mancini, A. Ciervo, G. Rezza)Address for correspondence: Giordano Madeddu, Dipartimento di Medicina Clinica, Sperimentale e Oncologica, Università degli Studi di Sassari, Via de Nicola 1, 07100 Sassari, Italy; email: giordano.madeddu@uniss.it42012184702704Keywords: Rickettsia monacensisMSF–like illnessSardiniaItalyMediterranean spotted fever (Boutonneuse fever)Rickettsiavector-borne infections

To the Editor: Rickettsia conorii, the etiologic agent of Mediterrenean spotted fever (MSF), is transmitted to humans by the brown dog tick (Rhipicephalus sanguineus). MSF is endemic to Italy; incidence is highest in the south and on the islands of Sardinia and Sicily (1). Recently, the use of molecular methods has enabled identification of other rickettsiae of the spotted fever group (SFG) from Ixodes ricinus ticks in northeastern Italy and in other areas of Europe (26). R. monacensis was identified as an etiologic agent of MSF-like illness in Spain (7).

We report a case of MSF-like illness in a 28-year-old man from Sassari in northwestern Sardinia who was admitted to the Infectious Disease Unit of the University of Sassari Hospital in April 2011. At admission, he reported fever (38.2°C) and headache of 2 days’ duration. At physical examination, he had a crusty skin lesion surrounded by edema and erythema, which was compatible with inoculation eschar, on the left calf. He had no rash. Laboratory results showed a slight leukocyte increase, hypocromic and microcytic anemia (hemoglobin 10.6 g/dL [reference range 13.1–17.1 g/dL], mean corpuscular volume 67.7 fL [reference range 81–88 fL], mean corpuscular hemoglobin concentration 29.6 g/dL [reference range 33–35 g/dL]), hyperbilirubinemia (total bilirubin 1.36 mg/dL [reference range 0.2–1.3 mg/dL], direct bilirubin 0.49 mg/dL [reference range 0.0–0.6 mg/dL]), and erythrocyte sedimentation rate 37 mm/h (reference range 0–25 mm/h). The remaining parameters were within reference ranges. A small skin sample taken from the inoculation eschar and whole blood were stored at –30°C. The patient immediately started taking doxycycline 100 mg every 12 hours. Serologic tests were negative for R. conorii IgM and IgG (ELISA) and positive for SFG Rickettsia spp. IgG on indirect immunofluorescence with a titer of 128. After 24 hours of antimicrobial drug therapy, he was afebrile; he was discharged on day 3. He completed a 7-day course of doxycycline at home and recovered completely.

The skin biopsy sample, collected in phosphate-buffered saline, and whole blood were obtained before antimicrobial therapy began and were subjected to DNA extraction. Bacterial detection and identification were conducted by using molecular methods based on real-time PCR, classical PCR, and nucleotide sequencing (Table).

Selected inner primers used to amplify rickettsial <italic>glt</italic>A and <italic>omp</italic>A genes*
Rickettsial groupsGenePrimerNucleotide sequence, 5′ → 3′Product size, bpReference
Rickettsiae spotted fever group plus typhus groupgtlAgltA–FTCGCAAATGTTCACGGTACTTT74 (8)
gltA–RTCGTGCATTTCTTTCCATTGTG
Rickettsiae ompAompAompA–FATGGCGAATATTTCTCCAAAA632 (9)
ompA–RGTTCCGTTAATGGCAGCATCT

*gltA, citrate synthase; ompA, outer membrane protein A.

A set of primers for gltA gene that encodes the citrate synthase enzyme (8) was used to determine that the organism belonged to the genus Rickettsia, which includes the SFG and typhus group. Each real-time PCR reaction was performed by QuantiTect SYBR Green PCR kit (QIAGEN, Hilden, Germany) by using 20 ng of purified DNA. R. conorii and R. typhii were used as positive controls for SFG and typhus group, and Anaplasma phagocytophilum, Bartonella henselae, Ehrlichia chaffeensis, and Coxiella burnetii (Bartonellaceae and Coxiellaceae members) served as negative controls. Results were checked for the specific molecular length by electrophoresis on a 3% (wt/vol) agarose gel.

The skin biopsy specimen of the inoculation eschar was positive for Rickettsia spp. The whole blood sample was negative for Rickettsia spp.

These results were confirmed by amplification of the ompA gene by using the ompA–F and ompA–R primers (9) and by the sequencing of the PCR amplicon. The nucleotide sequence analyzed by using the BLAST search tool (www.ncbi.n/m.nib.gov/blast) showed 100% identity with the R. monacensis isolate N72 (GenBank accession no. FJ919650.1). We identified R. monacensis as cause of MSF-like illness in the patient reported here.

Our results have several clinical and microbiological implications. Although MSF-like illness is highly endemic to Sardinia, to our knowledge no pathogens other than R. conorii had ever been identified. Antibodies against R. monacensis were not detected by the R. conorii ELISA commonly used in hospital laboratories. In contrast, indirect immunofluorescence, which cannot distinguish between rickettsial species because of cross-reactivity, was positive. Therefore, the cocirculation of R. monacensis and, possibly, of other SFG rickettsiae, could lead to misdiagnosis and therapeutic delay. Furthermore, in consideration of the negative result in whole blood, a small skin sample from the eschar might improve the diagnostic sensitivity of PCR.

We did not perform entomologic studies. However, I. ricinus ticks, which are considered vectors of R. monacensis, are widely distributed in Italy and have been found in Sardinia, although less often than other tick species (10). Moreover, it is not excluded that other ticks might act as vectors for R. monacensis in Sardinia, where ticks of the genus Rhipicephalus are prominent. Molecular investigations of ticks could better clarify the extent of circulation of SFG rickettsiae in Sardinia.

Identification of R. monacensis as a cause of MSF-like illness in Sardinia expands the list of pathogenic rickettsiae circulating in Italy. It also highlights the need for further investigation in humans and vectors to understand infection dynamics and improve diagnosis and treatment of this potentially life-threatening disease.

Suggested citation for this article: Madeddu G, Mancini F, Caddeo A, Ciervo A, Babudieri S, Maida I, et al. Rickettsia monacensis as cause of Mediterranean spotted fever–like illness, Italy [letter]. Emerg Infect Dis [serial on the Internet]. 2012 Apr [date cited]. http://dx.doi.org/10.3201/eid1804.111583

This study was supported by a Centro Nazionale per il Controllo e la Prevenzione delle Malattie Project of the Italian Health Ministry.

ReferencesCiceroni L, Pinto A, Ciarrocchi S, Ciervo A. Current knowledge of rickettsial diseases in Italy. Ann N Y Acad Sci. 2006;1078:143910.1196/annals.1374.02417114696Márquez FJ, Muniain MA, Soriguer RC, Izquierdo G, Rodríguez-Bano J, Borobio MV. Genotypic identification of an undescribed spotted fever group rickettsia in Ixodes ricinus from southwestern Spain. Am J Trop Med Hyg. 1998;58:57079598443Beninati T, Lo N, Noda H, Esposito F, Rizzoli A, Favia G, First detection of spotted fever group rickettsiae in Ixodes ricinus from Italy. Emerg Infect Dis. 2002;8:983612194779Simser JA, Palmer AT, Fingerle V, Wilske B, Kurtti TJ, Munderloh UG. Rickettsia monacensis sp. nov., a spotted fever group Rickettsia, from ticks (Ixodes ricinus) collected in a European city park. Appl Environ Microbiol. 2002;68:45596610.1128/AEM.68.9.4559-4566.200212200314Sréter-Lancz Z, Sréter T, Széll Z, Egyed L. Molecular evidence of Rickettsia helvetica and R. monacensis infections in Ixodes ricinus from Hungary. Ann Trop Med Parasitol. 2005;99:3253010.1179/136485905X2802715829141Chmielewski T, Podsiadly E, Karbowiak G, Tylewska-Wierzbanowska S. Rickettsia spp. in ticks, Poland. Emerg Infect Dis. 2009;15:486810.3201/eid1503.08071119239772Jado I, Oteo JA, Aldámiz M, Gil H, Escudero R, Ibarra V, Rickettsia monacensis and human disease, Spain. Emerg Infect Dis. 2007;13:1405718252123Paris DH, Blacksell SD, Stenos J, Graves SR, Unsworth NB, Phetsouvanh R, Real-time multiplex PCR assay for detection and differentiation of rickettsiae and orientiae. Trans R Soc Trop Med Hyg. 2008;102:1869310.1016/j.trstmh.2007.11.00118093627Zhang L, Jin J, Fu X, Raoult D, Fournier PE. Genetic differentiation of Chinese isolates of Rickettsia sibirica by partial ompA gene sequencing and multispacer typing. J Clin Microbiol. 2006;44:2465710.1128/JCM.02272-0516825365Di Todaro N, Piazza C, Otranto D, Giangaspero A. Ticks infesting domestic animals in Italy: current acarological studies carried out in Sardinia and Basilicata regions. Parassitologia. 1999;41(Suppl 1):394011071541