We report molecular evidence of Tula hantavirus as an etiologic agent of pulmonary-renal syndrome in an immunocompromised patient. Acute hantavirus infection was confirmed by using serologic and molecular methods. Sequencing revealed Tula virus genome RNA in the patient’s blood. This case shows that Tula virus can cause serious disease in humans.
Hantaviruses are enveloped RNA viruses carried by rodents and insectivore species. At least 5 hantavirus species are known to circulate in Europe: Dobrava-Belgrade virus, Puumala virus (PUUV), Seoul virus, Saarema virus, and Tula virus (TULV). The first 3 are well-characterized human pathogens; however, little is known about TULV human pathogenicity.
The species
The causative agents of hemorrhagic fever with renal syndrome in Central Europe are Dobrava-Belgrade virus and PUUV (
A 14-year-old boy from a rural region in the northeast part of the Czech Republic (Opava region) has received treatment for acute lymphoblastic leukemia since July 2011. Because of the biologic properties of the malignity, the boy was classified into the high-risk group of the treatment protocol. The intensive part of the treatment was finished in August 2012, and the patient has continued maintenance therapy since then.
During his first week of maintenance therapy, the patient experienced a respiratory infection with temperatures of ≈38°C, mild dyspnea, and a cough. These symptoms spontaneously disappeared. One week later, the patient had temperatures up to 38.5°C. He reported a headache, lack of appetite, and vomiting but no cough or respiratory distress. Upon the patient’s admission to the hospital, at the end of September 2012, his conditions deteriorated. He was febrile at 39.3°C and moderately dehydrated. Dyspnea with desaturation developed, so he was transferred to the intensive care unit to receive oxygenotherapy. The antileukemic maintenance therapy therefore had to be interrupted. The x-ray and high-resolution computed tomographic scan revealed severe bilateral bronchopneumonia with a major fluidothorax and bilateral dystelectasis. He was then given amoxicillin/clavulanate, amikacin, and antimycotic drugs. Oliguria also developed, with a minimum of 0.3 mL/kg/h, and it was managed by diuretic medication. Hemodialysis was not needed. He had transiently increased blood pressure followed by hypotension.
Laboratory results revealed eosinophilia in the patient’s differential leukocyte count at a maximum of 59.3% (reference range 0%–5%), anemia with a minimal value of hemoglobin of 60.0 g/L (reference range 135–175 g/L), thrombocytopenia at 12 × 109/L (reference range 150–440 × 109/L), and C-reactive protein 70 mg/L (reference range 0–10 mg/L). Elevated values were detected for serum urea measured at 8.40 mmol/L (reference range 1.8–6.4 mmol/L), creatinine at 103 µmol/L (reference range 27–88 μmol/L), and D-dimers at 3.53 μg/mL (reference range 0–0.5 μg/mL). Other coagulation parameters were not affected. Moreover, erythrocyturia and hyaline cylinders were observed in urine samples. The serum amylase and liver enzyme levels were within reference ranges. The relapse of acute lymphoblastic leukemia was excluded by the bone marrow examination. Because of the patient’s severe thrombocytopenia, thromboconcentrate was administered.
During the course of the patient’s hospitalization, his clinical condition, computed tomographic scan, and chest radiographic findings, and laboratory parameters improved. His renal failure gradually subsided with a transient polyuric phase. After 3 weeks of hospitalization, the patient resumed maintenance antileukemic therapy, and he was discharged from the hospital in good condition.
Serum samples taken on days 11, 12, 20, and 39 were tested for IgG and IgM antibodies to hantaviruses by using ELISA (Anti-Hanta Virus Pool 1 “Eurasia”; Euroimmun, Lübeck, Germany). The serum sample taken on day 12 was further tested for IgG and IgM antibodies by using Immunoblot (Anti-Hanta Profile 1; Euroimmun). ELISA results are considered positive when the index value (optical density divided by the cutoff value) is >1.1. Serology results suggested that the causative agent was a hantavirus antigenically closer to PUUV (
| Virus | Serum samples obtained on day | Positivity range (IP)† | |||
|---|---|---|---|---|---|
| 11 | 12 | 20 | 39 | ||
| Hantavirus IgG ELISA | 0.26 | 0.38 | >1.1 | ||
| Hantavirus IgM ELISA | >1.1 | ||||
| Puumala virus IgG Immunoblot | ND | Negative | ND | ND | ND |
| Puumala virus IgM Immunoblot | ND | ND | ND | ND | |
| Dobrava virus IgG Immunoblot | ND | Negative | ND | ND | ND |
| Dobrava virus IgM Immunoblot | ND | Negative | ND | ND | ND |
| Hantaan virus IgG Immunoblot | ND | Negative | ND | ND | ND |
| Hantaan virus IgM Immunoblot | ND | Negative | ND | ND | ND |
*
†ELISA serology is considered positive when the index value (optical density divided by the cutoff value) is >1.1.
RNA was extracted from an EDTA plasma sample taken on day 11. Hantavirus RNA was detected by nested reverse transcription PCR performed with pan-hantaviral large (L) segment specific primers (
| Primer | Step | Target segment | Sequence (5′→ 3′) | Reference |
|---|---|---|---|---|
| HAN-L-F1 | 1st PCR | Large | ATGTAYGTBAGTGCWGATGC | ( |
| HAN-L-R1 | 1st PCR | Large | AACCADTCWGTYCCRTCATC | ( |
| HAN-L-F2 | 2nd PCR, sequencing | Large | TGCWGATGCHACIAARTGGTC | ( |
| HAN-L-R2 | 2nd PCR, sequencing | Large | GCRTCRTCWGARTGRTGDGCAA | ( |
| S1 | 1st PCR | Small | GGMCAGACAGCAGAYTGG | ( |
| S2 | 1st PCR | Small | AGCTCAGGATCCATRTCATC | ( |
| MaS4F | 2nd PCR, sequencing | Small | CATCACAGGSYTTGCACTTGCAAT | ( |
| MaS5C | 2nd PCR, sequencing | Small | TCCTGAGGCTGCAAGGTCAA | ( |
TULV RNA detection was confirmed by another PCR and sequencing experiment with small (S) segment Tula virus-specific primers previously published (
The EDTA plasma sample collected during the acute phase was positive for hantavirus RNA. Sequencing analysis of both L- and S-segments confirmed that the causative agent was TULV. The phylogenetic trees for partial L- and S-segments (
Phylogenetic tree (neighbor-joining analysis with maximum composite likelihood method) of Tula virus on the basis of large segment partial sequences (nt 2957–3337), Ostrava, Czech Republic, October 2012 GenBank accesion numbers: Haantaan virus (NC_005222), Puumala virus (Z66548), Prospect Hill virus (EF646763), 09/1905/Magr (HQ728460), 08/712/Arv (HQ728453), 09/2155/Arv (HQ728456), 08/525/Marv (HQ728461), 152/Arv (HQ728459), 78/Marv (HQ728464), 20/Marv (HQ728462), 109/Arv (HQ728457), 127/Arv (HQ728458), 09/1026/Arv (HQ728455), Moravia/5302v (AJ005637), JiTr/Opava /12 (KC522413), Hodos/Ma99/99 (FJ495101), Sred ob Dravi/Ms51/97 (FJ495102), Griblje/Ma57/01 (FJ495099), Sestrze/Mag98/02 (FJ495100). Bootstrap values ≥70%, calculated from 1,000 replicates, are shown at the tree branches. Arrow indicates strain isolated in this study. The tree is drawn to scale. The scale bar indicates an evolutionary distance of 0.05 substitutions per position in the sequence.
Phylogenetic tree (neighbor-joining analysis with maximum composite likelihood method) of Tula virus on the basis of small segment partial sequences (nt 428–758), Ostrava, Czech Republic, October 2012 GenBank accession numbers: Haantaan virus (NC_005218), Puumala virus (NC_005224), Prospect Hill virus (Z49098), Isla Vista virus (U19302), Karatal322 (AM945877), Taldykorgan343 (AM945879), Karatal340 (AM945878), Omsk23 (AF442621), Tula76 (Z30941), Tula53 (Z30942), Tula175 (Z30943), Lodz-1 (AF063892), Lodz-2 (AF063897), Cottbus/D63/98 (AF289821), Cottbus/D5/98 (AF289819), Cacak/Serbia (AF017659), Kosice/667 (Y13980), Kosice/144 (Y13979), Waldnaab/g20-s (AF164093), c109s (AF164094), Wels/O64 (U95309), Wels/O24 (U95302), JiTr/Opava /12 (KC494908), Moravia/02 (Z49915), Moravia/94 (Z48741), Moravia/86 (Z48573), Moravia/93 (Z48574), Koziky/47 (AJ223600), Koziky/76 (AJ223601), Korneuburg/K11 (U95305), Korneuburg/K26 (U95310), Malacky/370, Malacky/32. Bootstrap values ≥70%, calculated from 1,000 replicates, are shown at the tree branches. Arrow indicates strain isolated in this study. The tree is drawn to scale. The scale bar indicates an evolutionary distance of 0.02 substitutions per position in the sequence.
Although the presence of TULV in the common vole population in the Czech Republic has been documented, no evidence of its pathogenicity in humans has been shown. Specific antibodies against TULV have been identified in a healthy blood donor in the Czech Republic (
We provide the molecular evidence of human symptomatic TULV infection. The clinical symptoms included both renal and pulmonary involvement with dominating respiratory failure corresponding to the hantavirus pulmonary syndrome. The course of the disease was severe, and the delayed occurrence of TULV IgG was most likely caused by the patient’s immunodeficiency. The laboratory findings were typical for hantavirus infection, with strongly decreased platelet count but only moderately elevated serum creatinine and urea.
Furthermore, during the acute stage, viral RNA was detected in the patient’s serum, which strongly suggests that TULV is a causative agent of the critical stage. This case illustrates that TULV can cause life-threatening disease in an immunocompromised patient, although under normal circumstances it is a nonpathogenic virus (
The authors contributed equally to this article.
We thank Zuzana Dostálová for language correction.
Dr. Zelená is a head of the Department of Virology (Institute of Public Health Ostrava) and of the National Reference Laboratory for Arboviruses of the Czech Republic. Her main research interests include arboviruses and vector-borne viruses, imported and emerging viruses, and diagnostic electron microscopy.