This virus typically causes illness in young children but was found to be associated with illness in adults.
Human parechovirus has rarely been shown to cause clinical disease in adults. During June–August 2008, a total of 22 adults sought treatment at Yonezawa City Hospital in Yamagata, Japan, for muscle pain and weakness of all limbs; most also had fever and sore throat. All patients received a clinical diagnosis of epidemic myalgia; clinical laboratory findings suggested an acute inflammatory process. Laboratory confirmation of infection with human parechovirus type 3 (HPeV3) was made for 14 patients; we isolated HPeV3 from 7 patients, detected HPeV3 genome in 11, and observed serologic confirmation of infection in 11. Although HPeV3 is typically associated with disease in young children, our results suggest that this outbreak of myalgia among adults was associated with HPeV3 infection. Clinical consideration should be given to HPeV3 not only in young children but also in adults when an outbreak occurs in the community.
Human parechovirus (HPeV) is a positive-sense, single-stranded RNA virus belonging to the family
HPeV1 and HPeV2 mainly cause mild gastrointestinal or respiratory illness, but more serious diseases have been occasionally reported, including myocarditis, encephalitis, pneumonia, meningitis, flaccid paralysis, Reye syndrome, and fatal neonatal infection (
Although the seroprevalence of the recently discovered HPeV4–8 are unknown, HPeV1–3 infections usually occur in early infancy (
An unusual outbreak of epidemic myalgia among adults occurred during June–August 2008 in Yonezawa, Yamagata, Japan, and epidemiologic investigation found that it was associated with HPeV3 infection. We describe this outbreak and provide expanded information about the clinical spectrum of HPeV3 infection.
During June 17–August 6, 2008, an outbreak of an unknown disease was observed among adults in Yonezawa, Yamagata, Japan. A total of 22 patients who lived in the city of Yonezawa who had myalgia, muscular weakness, sore throat, and orchiodynia (among men) sought treatment at Yonezawa City Hospital. Because all had symptoms of severe myalgia, these patients were given a diagnosis of with acute myalgia syndrome of unknown cause. The patients consisted of 15 men and 7 women ages 25–66 years (mean 37 years). Because several patients had contact with other persons who had similar symptoms, the outbreak was considered to be associated with an infectious agent. Virologic and serologic analyses were carried out to find the associated agent. This study was approved by the Ethics Committee of the Yonezawa City Hospital.
Throat swab and stool specimens were collected from 14 patients (
| Case-patient no. | Age, y/sex | Illness onset date | Hospital visit date | Clinical symptoms | Laboratory test results† | Virus isolation | RT-PCR for HPeV3 | Neutralizing antibody titer against HPeV3 (d after illness onset) | |||
|---|---|---|---|---|---|---|---|---|---|---|---|
| CPK | CRP | MYO | Throat swab/stool | Serum | |||||||
| 36/M | Jun 13 | Jun 17 | Myalgia, weakness, fever | 222 | 2.3↑ | 66.0↑ | Throat swab –, stool – | Throat swab –, | – | ||
| 2 | 66/F | Jun 16 | Jun 17 | Myalgia, weakness | 66 | 1.5↑ | 26.0 | ND‡ | ND | – | 64 (58) |
| 3 | 25/M | Jun 20 | Jun 25 | Myalgia, weakness, fever, orchiodynia | 201 | 0.8↑ | 148.0↑ | ND | ND | – | 16 (6), 16 (26) |
| 31/M | Jun 21 | Jun 24 | Myalgia, weakness, fever, sore throat | 239 | 0.5↑ | 66.0↑ | ND | ND | |||
| 5 | 32/M | Jun 22 | Jun 24 | Myalgia, weakness, fever, sore throat | 1,334↑ | 5.0↑ | 138.8↑ | Throat swab –, stool – | Throat swab –, stool – | ND | ND |
| 43/M | Jun 24 | Jun 25 | Myalgia, weakness, fever, sore throat | 277 | 2.0↑ | 73.0↑ | ND | ND | – | ||
| 30/F | Jun 26 | Jul 2 | Myalgia, weakness, fever, | 581↑ | 0.1 | 110.0↑ | ND | ND | – | ||
| 28/M | Jun 29 | Jul 1 | Myalgia, weakness, fever, sore throat, orchiodynia | 283 | 4.4↑ | 83.0↑ | Throat swab –, | ||||
| 39/F | Jun 30 | Jul 7 | Myalgia, weakness, fever, sore throat | 262↑ | 0.7↑ | 81.0↑ | Throat swab –, | – | |||
| 36/M | Jul 1 | Jul 4 | Myalgia, weakness, fever, sore throat | 693↑ | 0.4↑ | 230.0↑ | Throat swab –, | Throat swab –, | – | ||
| 35/M | Jul 3 | Jul 6 | Myalgia, weakness, fever, sore throat | 782↑ | 1.1↑ | 124.4↑ | Throat swab –, | Throat swab –, | – | ||
| 38/M | Jul 3 | Jul 6 | Myalgia, weakness, fever, sore throat | 321↑ | 0.2 | 201.0↑ | Throat swab –, stool – | Throat swab –, stool – | – | ||
| 38/F | Jul 4 | Jul 4 | Myalgia, weakness, fever, sore throat | 166↑ | 0.9↑ | 121.6↑ | – | ||||
| 37/F | Jul 6 | Jul 12 | Myalgia, weakness, seizures | 426↑ | 0.2 | 253.4↑ | Throat swab –, | – | |||
| 48/M | Jul 8 | Jul 11 | Myalgia, weakness, sore throat | 1,048↑ | 1.9↑ | 193↑ | Throat swab –, stool – | ND | ND | ||
| 16 | 41/M | Jul 9 | Jul 11 | Myalgia, fever, sore throat | 88 | 6.8↑ | 29 | Throat swab –, stool – | Throat swab –, stool – | – | 8 (9,63) |
| 17 | 26/F | Jul 11 | Jul 14 | Myalgia, weakness, fever, | 45 | 0.7↑ | 18 | Throat swab –, stool – | Throat swab –, stool – | – | 16 (61) |
| 36/M | Jul 11 | Jul 14 | Myalgia, weakness, fever, sore throat orchiodynia | 355↑ | 0.9↑ | 87↑ | Throat swab –, | Throat swab ND, s | – | 8 (12) | |
| 19 | 23/M | Jul 17 | Jul 18 | Myalgia, weakness, fever, sore throat | 165 | 1.7↑ | 31 | Throat swab –, stool – | Throat swab ND, stool – | – | <8 (1) |
| 20 | 34/M | Jul 19 | Jul 20 | Myalgia, weakness, fever, | 1,598↑ | 0.5↑ | 75.2↑ | ND | ND | – | 16 (13,24) |
| 21 | 38/F | Jul 31 | Aug 4 | Myalgia, weakness, fever, sore throat | 43 | 5.5↑ | 35 | ND | ND | – | <8 (4) |
| 55/M | Aug 6 | Aug 6 | Myalgia, weakness, fever, sore throat, orchiodynia | 556↑ | 4.9↑ | 26.8 | ND | ND | <8 (1) | ||
*
Virus isolation was carried out using a described microplate method (
RNA was extracted from 200 μL of each throat swab specimen or 10% stool suspension using a High Pure Viral RNA Kit (Roche Diagnostics, Manheim, Germany) according to the manufacturer’s instructions and then transcribed into complementary DNA (cDNA) as described (
Ultra-high throughput direct sequencing analysis was carried out as described (
An ≈300-bp length DNA library was prepared from a mixture of 2 µg of total DNA and ds-cDNA by using a genomic DNA sample prep kit (Illumina, San Diego, CA, USA), and DNA clusters were generated on a slide using a Single Read Cluster Generation kit version 4 on an Illumina cluster station (Illumina) according to the manufacturer’s instructions. To obtain ≈1.0 × 107 clusters for 1 lane, the general procedure as described in the manufacturer’s standard recipe was performed. All sequencing runs for 83-mers were performed with GA II using the Illumina Sequencing Kit version 5. Fluorescent images were analyzed using the Illumina SCS2.8/RTA1.8 to obtain FASTQ formatted sequence data. The obtained DNA sequence reads were investigated by using a MEGABLAST search (
RT-PCR was performed by using ≈100 ng of total RNA, the appropriate primer pair, and the PrimeScript II High Fidelity One-Step RT-PCR Kit (TaKaRa, Shiga, Japan). The following quantitative RT-PCR program was used: reverse transcription reaction 45°C for 10 min; initial denaturation 94°C for 2 min; and 3 steps of amplification (× 35 cycles) at 98°C for 10 s, 55°C for 15 s, and 68°C for 1 min. PCR products were resolved and purified by agarose gel electrophoresis and then sequenced by Sanger sequencing by using a BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA).
After HPeV3 was detected in the specimens from case-patient 11 by ultra-high throughput direct sequencing analysis, to investigate whether HPeV3 was associated with the myalgia epidemic, we repeated the virus isolation focusing on HPeV3, using GMK, Vero, and LLC-MK2 cell lines using the 28 stocked throat swab and stool samples shown in
| Primer | Nucleotide sequence, 5′ → 3′ | Nucleotide position* |
|---|---|---|
| Parecho3-F2K | AACAAGTGACACTATGGATCTGATC | 576–601 |
| Parecho3-F3K | CAAAGTAGCAGATGATGCTTCCAA | 824–849 |
| Parecho3-F4K | CAAGCCAAATATTTTGCTGCAGTAA | 1165–1190 |
| Parecho3-F5K | TGCATTGGTGGTTTATGAGCCTAA | 1244–1268 |
| Parecho3-F21K | TCAGACAACACCACACCTTCAAG | 1822–1844 |
| Parecho3-VP1F1Y | GGGCCTTTGGGTAATGAGAAA | 2452–2472 |
| Parecho3-VP1F2Y | TGACAACATATTTGGTAGAGCTTGGT | 2538–2563 |
| Parecho3-F6K | AGGAGATAATGTATATCAATTGGAT | 3095–3120 |
| Parecho3-F7K | TGACGGCTGGTTTAATGTCAACTAT | 3368–3392 |
| Parecho3-F8K | CTGAATCAATGTCCAACACAGACGA | 3737–3761 |
| Parecho3-F9K | TGGACTATGCCTCTGATATTATTGT | 3994–4019 |
| Parecho3-F10K | AATAATGGCCATTTGCTTTAGGAGT | 4098–4122 |
| Parecho3-F11K | CTTGTAAATTAAATGGTGTGTACAC | 4304–4328 |
| Parecho3-F12K | ACTAGGAAGGAGAAAGATATTGAAA | 4402–4426 |
| Parecho3-F13K | CAGCCAAAGCATATAGTAGGGCTG | 4609–4633 |
| Parecho3-F14K | TTGAACAAATGGAAGCCTTCATTGA | 4916–4940 |
| Parecho3-F15K | GTTGTAGACTGGTTCAGTAGTAAG | 5011–5034 |
| Parecho3-F16K | AAAGGAACTTTCCCAGTCACGCAGA | 5201–5225 |
| Parecho3-F17K | CAGAGAGTATGTTGATTTGGATGAC | 5553–5576 |
| Parecho3-F18K | GTGGCTATTCCTTTCAATTTTCTT | 5778–5802 |
| Parecho3-F19K | GGCCCAGCAGTTTTAAGCAAATCAG | 5863–5947 |
| Parecho3-F20K | TTGTCATGATTCACCTGATCTTGTC | 6608–6633 |
| Parecho3-R13K | AGTTTGTGGTATTTACAGTGGTTGT | 912–938 |
| Parecho3-R11K | TTTTAACGTAGTTTGTGTCTGCA | 1380–1402 |
| Parecho3-R15 | CATGTATAGAATATGAATGTTTATT | 2673–2697 |
| Parecho3-VP1R2Y | ACCCCTGCTCTGCCATGTATA | 2693–2710 |
| Parecho3-VP1R1Y | TCCCGTGCATCATTGGTCTA | 2883–2902 |
| Parecho3-R10K | TGACAGATGATTCAAGATACTTCAC | 3238–3253 |
| Parecho3-R9K | AGTGGTACACTTCTGCACAAGTAAG | 3468–3492 |
| Parecho3-R8K | ATCCACCAATCAATATGTCTGAATG | 3859–3884 |
| Parecho3-R7K | TGGATAGTGTGTGTGTTAGGAAAGA | 4264–4288 |
| Parecho3-R5K | CCACTTTAGAAATAAGCAGACCACC | 5701–5725 |
| Parecho3-R4K | CCATTTTGACTTCCACTGCTCCA | 5901–5923 |
| Parecho3-R3K | CCTAAATTTGGACTTGACACAGG | 5993–6015 |
| HPeV3whole-RT-RK | TTTTGGTATGTCCAATATTCCAAATTAGTG | 7296–7321 |
To further evaluate the role of HPeV3 in this outbreak of myalgia, we measured the neutralizing antibody response against HPeV3 in 1–5 serum samples from 20 of the patients (
The 22 case-patients in this outbreak had similar symptoms (
Creatinine phosphokinase (CPK), C-reactive protein, and myoglobin levels were higher than reference ranges in 12, 19, and 16 patients, respectively (
Magnetic resonance imaging (MRI) of the muscles of case-patients 4, 13, and 15 showed increased signal intensity on T2-weighted images. We suspected that case-patient 14 had encephalitis on the basis of clinical symptom, but results of MRI of the brain and cerebrospinal fluid examination did not support this diagnosis. Clinical symptoms and laboratory findings for all patients were consistent with inflammatory myositis.
No viruses were detected by screening steps at the Yamagata Prefectural Institute of Public Health using virus isolation and RT-PCR targeting enteroviruses, HPeV1, and HPeV2. Thus, we investigated possible uncharacterized pathogens by using direct DNA sequencing. To determine potential pathogens for the patients, we performed direct sequencing of a mixture of purified DNA and ds-cDNA from the total RNA extracted from either the throat swab or stool specimens of case-patient 11. No other possible viral sequences were detected by the high-throughput sequencing for case-patient 11.
Next-generation DNA sequencer GA II produced ≈1.5 × 107 83-mer short reads from the mixed DNA library. To exclude the human-derived read sequences, all obtained reads were initially aligned to a reference sequence of human genomic DNA, followed by quality trimming to remove low-quality reads and exclude reads with similarities to ambiguous human sequences. All remaining possible pathogen reads were further analyzed using a MegaBLAST search against nonredundant databases.
One type of HPeV was found in the analyzed specimens. Three HPeV reads were identified from the throat swab specimen and 1,505 HPeV reads from the stool specimen of case-patient 11. To further characterize the type of HPeVs detected, de novo assembly was performed by using Euler-SR version 1.0 (
To determine the whole HPeV sequence for the isolates we obtained, RT-PCR was performed (
Schematic representation of the human parechovirus 3 (HPeV3) genome sequence and coding polyprotein. Reverse transcription PCR results are shown below the sequence. VP, viral protein; UTR, untranslated region.
Phylogenetic tree of the viral protein 1 region sequence in the available human parechovirus (HPeV) genomes, including HPeV1–8. The tree was constructed by the neighbor-joining method with 1,000× bootstrapping. Scale bar indicates nucleotide substitutions per site.
We passaged isolates 6 times using GMK and LLC-MK2 cell lines, but all strains except 1 (isolated after 5 passages) were recovered within 3–4 passages. We could not isolate HPeV3 using the LLC-MK2 cell line provided by the National Institute of Infectious Diseases Japan, but we were successful when using LLC-MK2 cell line from the Niigata Prefectural Institute of Public Health and Environmental Sciences. In total, we isolated HPeV3 strains from either the throat swab or stool specimen of 7/14 patients analyzed (
RT-PCR was successful in detecting the HPeV3 genome in the throat swabs or stool specimens from 9/14 patients (
Of 20 analyzed patients, seroconversion was observed in 6 patients. A 4-fold increase in neutralization antibodies against HPeV3 was confirmed in 5 patients (
By conducting virus isolation, RT-PCR, and serologic examination, we confirmed an outbreak of epidemic myalgia among adults in Yonezawa, Yamagata, Japan, during June–August 2008 was associated with HPeV3 infection. Although we did not detect any virus in our first screening, direct sequencing analysis suggested that these patients were infected with HPeV3. We next tried to detect this virus specifically and isolated HPeV3 strains from the throat swabs or stool specimens of 7 patients; detected the virus genome in the throat swabs or stool or serum specimens of 11 patients; and observed seroconversion or 4-fold increases in antibodies against HPeV3 in 11 patients. Altogether, we confirmed HPeV3 infection in 14 of the 22 patients in this outbreak. All patients, except 1 who experienced complications related to epilepsy, recovered completely within 1 week after the onset of illness through treatment with antiinflammatory drugs only.
Enteroviruses have been implicated in the pathogenesis of human neuromuscular diseases because of their association with certain acute and chronic acquired myopathies and paralytic motor neuron syndromes (
In enterovirus viremia, viruses enter through the oral or respiratory route, replicate in the pharynx and alimentary tract, spread to multiple organs such as the central nervous system, heart, and skin, and then diminish and disappear after neutralizing serum antibodies are produced (
In this study, we showed HPeV3 viremia in 3 patients without neutralizing antibodies within a few days after the onset of illness. Thus, we conclude that HPeV3 viremia affects many organs, including the peripheral muscles as well as the organs normally targeted by enteroviruses. Several male patients in the Yonezawa outbreak also had orchitis, which is described as a symptom of epidemic pleurodynia (
HPeV often grows poorly in culture, and typing reagents are not widely available for newly discovered types (HPeV3–14) (
Although we used a new direct-sequence analysis method and a slightly older RT-PCR method to amplify the HPeV3 genome in this study, new laboratory diagnostic procedures for HPeVs have been developed during the past few years. HPeV RT-PCRs now exist to detect all known HPeV types with great sensitivity (
Our finding of HPeV3 infection in adults conflicts with most of the literature, which suggests that HPeV3 infections occur in early infancy (
It remains unclear why these HPeV3 infections occurred among adults in 2008. HPeV3 infections occur in the spring and summer seasons, whereas HPeV1 infections are observed in small numbers throughout the year but predominantly during the fall and winter (
In conclusion, we document detection of HPeV3 infection among adult patients with epidemic myalgia in Yamagata, Japan, during 2008. Clinical consideration should be given to HPeV3 not only in young children but also in adults when an HPeV3 outbreak occurs in the community. Continued research on adults with HPeV3 infection is needed to further understand the etiology and epidemiology of HPeV3.
Current affiliation: Tokyo University of Agriculture and Technology Research and Education Center for Prevention of Global Infectious Diseases of Animals, Tokyo, Japan.
We thank the medical staff and people of the Yamagata Prefecture for their collaboration in specimen collection for the surveillance of viral infectious diseases. We also thank M. Kon and T. Tamura and the Niigata Prefectural Institute of Public Health and Environmental Sciences for providing us with LLC-MK2 cell line.
This work was supported by a grant-in-aid from the Japan Society for the Promotion of Science and for Research on Emerging and Re-emerging Infectious Diseases of the Ministry of Health, Labour and Welfare, Japan.
Dr Mizuta is the vice-director of Yamagata Prefectural Institute of Public Health, Yamagata, Japan. His research focuses on epidemiology and etiology of respiratory viruses.