Emerg Infect DisEmerging Infect. DisEIDEmerging Infectious Diseases1080-60401080-6059Centers for Disease Control and Prevention22305204331046111-130510.3201/eid1802.111305DispatchDispatchPhylogeography of Francisella tularensis subsp. holarctica, EuropePhylogeography of F. tularensis, EuropeGyuraneczMiklós1BirdsellDawn N.1SplettstoesserWolfSeiboldErikBeckstrom-SternbergStephen M.MakraiLászlóFodorLászlóFabbiMassimoVicariNadiaJohanssonAndersBuschJoseph D.VoglerAmy J.KeimPaulWagnerDavid M.Hungarian Academy of Sciences, Budapest, Hungary (M. Gyuranecz);Northern Arizona University, Flagstaff, Arizona, USA (D.N. Birdsell, J.D. Busch, A.J. Vogler, P. Keim, D.M. Wagner);Bundeswehr Institute of Microbiology, Munich, Germany (W. Splettstoesser, E. Seibold);Translational Genomics Research Institute, Phoenix, Arizona, USA (S.M. Beckstrom-Sternberg, P. Keim);Szent István University, Budapest (L. Makrai, L. Fodor);Istituto Zooprofilattico Sperimentale della Lombradia e dell’Emilia Romagna, Pavia, Italy (M. Fabbi, N. Vicari);Umeå University, Umeå, Sweden (A. Johansson)Address for correspondence: David M. Wagner, PO Box 4073, Center for Microbial Genetics and Genomics, Northern Arizona University, Flagstaff AZ, 86011-4073, USA; email: dave.wagner@nau.edu22012182290293

Francisella tularensis subsp. holarctica isolates from Austria, Germany, Hungary, Italy, and Romania were placed into an existing phylogeographic framework. Isolates from Italy were assigned to phylogenetic group B.FTNF002–00; the other isolates, to group B.13. Most F. tularensis subsp. holarctica isolates from Europe belong to these 2 geographically segregated groups.

Keywords: Francisella tularensis subsp. holarcticabioterrorismphylogeographySNPcanSNPzoonosesEurope

Francisella tularensis is the etiologic agent of tularemia and a highly virulent category A biothreat agent (1,2). The most widely distributed subspecies is F. tularensis subsp. holarctica, which is found throughout much of the Northern Hemisphere and is the only subspecies found in Europe (3). Despite its wide geographic distribution, F. tularensis subsp. holarctica contains low genetic diversity, which indicates recent emergence (4). A recent global phylogeographic analysis (5), and several subsequent analyses (69), assigned most isolates from Europe to 2 phylogenetic groups: B.FTNF002–00 and B.13 (includes multiple subclades descended from branch B.13 [5,6,8]; branch and subclade nomenclature from [5] has been shortened by removing Br and extra 0s from individual branch and subclade names). These groups appear to be geographically segregated: only isolates from B.FTNF002–00 have been reported from the western European countries of Spain, France, and Switzerland, whereas B.13 is the only or dominant type reported from the Czech Republic, Finland, Georgia, Russia, Slovakia, and Ukraine (59). We provide additional information about the geographic distribution of these 2 groups using existing phylogenetic signatures (5,8) to place 45 isolates from Austria, Germany, Hungary, Italy, and Romania (Table A1) into the existing global phylogeographic framework.

The Study

All of the isolates were assigned to group B.FTNF002–00 or to group B.13. All 3 isolates from Italy were assigned to group B.FTNF002–00 (Figure 1, panel A). Although the sample size was small, these isolates were obtained in 3 different years (Table A1), which suggests that this group is ecologically established in Italy. These results increase the known geographic distribution of this group, which appears to be the dominant clone in western Europe (Figure 2, panel A, purple shading). All 42 isolates from Austria, Germany, Hungary, and Romania were assigned to group B.13 (Figure 1, panel A), further demonstrating that B.13 is the most prevalent group of F. tularensis subsp. holarctica in central and eastern Europe (Figure 2, panel A, red shading). Within group B.13, one isolate from Hungary was assigned to subclade B.23/14/25 (Figure 1, panel A); isolates from Finland, Russia, and Sweden were previously assigned to this subclade (6,8) (Figure 2, panel B). However, the other 41 isolates were assigned to subclade B.20/21 (Figure 1, panel A).

Existing phylogeny of Francisella tularensis subsp. holarctica. A) Single nucleotide polymorphism (SNP)–based phylogeny of F. tularensis subsp. holarctica derived from previous studies (5,6,8). Terminal subgroups representing sequenced strains are shown as stars, and intervening nodes representing collapsed branches are indicated by circles. Subclades within group B.13 are depicted in red. Isolates from Austria, Germany, Hungary, Italy, and Romania (n = 45) were assigned to existing subclades (black arrows) by using existing canonical SNP assays (5,8). B) Maximum parsimony phylogeny constructed by using SNPs discovered from 6 F. tularensis whole-genome sequences, including 5 strains from group B.13 and an outgroup strain, OSU18 (not shown). This phylogeny was rooted by using OSU18, and bootstrap values were based on 1,000 simulations by using a heuristic search. The newly sequenced Hungarian strain (Tul07/2007) is highlighted in gray.

Detailed geographic distribution and phylogeny of Francisella tularensis subsp. holarctica subclades within group B.13. A) Countries from which groups B.13 and B.FTNF002–00 have been reported. Countries of origin for isolates assigned to select subclades within group B.13 are indicated by the letters A–H. Red and purple shading indicates the known geographic distributions of groups B.13 and B.FTNF002–00, respectively, in this and previous studies (59). The country of Georgia, which also contains isolates from group B.13 but is not depicted in the map, is indicated by red text and a red arrow pointing toward its location. Isolates assigned to other phylogenetic groups within F. tularensis subsp. holarctica have been reported from some of these countries (5,8), but most isolates from these countries are from groups B.13 and B.FTNF002–00. B) Single nucleotide polymorphism–based phylogeny of previously (5,6,8) and newly identified subclades within the B.13 group of F. tularensis subsp. holarctica. Terminal subgroups representing sequenced strains are shown as stars, and intervening nodes representing collapsed branches are indicated by circles. The countries of origin for isolates assigned to each subclade are indicated: AUT, Austria; CE, central Europe, unknown country; CZE, Czech Republic; DEU, Germany; FIN, Finland; GEO, Georgia; HUN, Hungary; ITA, Italy; ROU, Romania; RUS, Russia; SWE, Sweden; UKR, Ukraine). For mapping purposes, letters are assigned to a previously identified subclade that contains a new isolate from Hungary now assigned to that subclade (A) and newly identified subclades (B–H). The number of isolates listed for each subclade refers only to isolates examined directly in this study (Table A1).

We identified new genomic signatures to provide increased genetic resolution within subclade B.20/21. Next-generation sequencing technology (Illumina Inc., San Diego, CA, USA) was used to sequence the genome of an isolate from Hungary (Tul07/2007, GenBank accession no. SRX025133) assigned to subclade B.20/21. Putative single nucleotide polymorphisms (SNPs) were identified in the resulting sequence and the genomes of 4 other strains previously assigned to group B.13 (LVS, AM233362.1; FSC 200, AASP00000000; RC503, SRX000104; Georgia F0673, SRX025885) by using an existing bioinformatics pipeline (5). The more distantly related strain OSU18 (CP000437.1) genome was also included as an outgroup. A maximum-parsimony tree was constructed by using the resulting ≈700 putative SNPs and PAUP 4.0b10 software (Sinauer Associates, Inc., Sunderland, MA, USA) (Figure 1, panel B). Most of the putative SNPs separated OSU18 from the B.13 strains (data not shown), but the remaining putative SNPs provided resolution among the B.13 strains, including 20 putative SNPs specific to the branch leading to the strain from Hungary (Figure 1, panel B). Consistent with previous analyses (Figure 1, panel A), the strain from Hungary clustered as a sister taxon to strain FSC 200 (Figure 1, panel B).

To show additional phylogenetic structure within subclade B.20/21, we designed genotyping assays targeting the 20 putative SNPs along the branch leading to the strain from Hungary (Figure 1, panel B) and screened them across 64 isolates assigned to subclade B.20/21. This analysis included the 41 isolates from Austria, Germany, Hungary, and Romania, as well as 23 additional isolates from central Europe, the Czech Republic, Finland, Russia, and Sweden that were previously assigned to this subclade (6,8) (Table A1). The assays were constructed and performed as described (5) by using an annealing temperature of 60°C. All 20 SNPs were laboratory confirmed, and 52 of the isolates were assigned to 6 new subclades (B.33/34, B.34/35, B.35/36, B.36/37, B.37/38, and B.Tul07/2007); the 12 other isolates remained in the basal subclade, now identified as B.20/21/33 (Figure 2, panel B; Table A1). Information about assays targeting canonical SNPs for the branches leading to the 6 new subclades are presented in the Table.

Conclusions

Our results are consistent with complex dispersal patterns within the B.13 group of F. tularensis subsp. holarctica. Several of the B.13 subclades identified in this study are broadly distributed throughout central and eastern Europe (Figure 2, panel A), including subclades B.20/21/33, B.33/34, and B.34/35. All of the new subclades containing >1 isolate have representatives from multiple countries (Figure 2, panel B). Other previously identified B.13 subclades, including B.27/28, B.LVS, B.23/14/25, and B.21/22 are also broadly distributed (Figure 2, panel A).

This study and previous studies have increased understanding of F. tularensis subsp. holarctica in Europe by placing isolates from multiple countries into the existing global phylogeographic framework. As a result, the genetic background is becoming defined for each country (i.e., the specific subtypes reported from each country). This information can be useful for identifying intentional (e.g., bioterrorism) or unintentional movement of F. tularensis subsp. holarctica between countries. For example, the isolate from Romania examined in this study was actually isolated in Italy from an infected hare that was shipped from Romania for hunting. Genotyping results are consistent with a Romanian origin for this isolate because it was assigned to the B.13 group that is widespread in central and eastern Europe (Figure 2, panel A) and not to the B.FTNF002–00 group, to which the isolates from Italy were assigned (Figure 1, panel A).

Understanding global phylogeographic patterns is possible only if isolates from multiple geographic locations are placed within the same framework (i.e., examined with the same genomic signatures). Because F. tularensis is genetically monomorphic and highly clonal, SNPs are preferred signatures for determining phylogenetic structure within this species (3). Vogler et al. (5) conducted the first SNP-based global phylogeographic analysis of F. tularensis. Subsequent studies (68) have used the SNP signatures described by Vogler et al. (5) and new SNPs discovered from new whole-genome sequences or multiple sequence typing data to further refine phylogeographic patterns within F. tularensis, particularly F. tularensis subsp. holarctica. These new signatures, when screened across diverse isolate collections, have identified new subclades within preexisting subclades. This pattern will continue as whole-genome sequencing becomes less expensive and more widely available. As a result, the nomenclature of phylogenetic groups within F. tularensis and the particular subclade to which a given isolate is assigned are constantly changing and will continue to change, which makes comparison of results and findings across different studies difficult. To address this problem, we have included all known F. tularensis subsp. holarctica SNP-based phylogenetic groups within our phylogenetic trees (Figure 1, panel A; Figure 2, panel B), including those discovered by other researchers. In addition, for the isolates analyzed in this study (Table A1), where applicable, we have listed the phylogenetic groups to which they were assigned in previous studies.

Suggested citation for this article: Gyuranecz M, Birdsell DN, Splettstoesser W, Seibold E, Beckstrom-Sternberg SM, Makrai L, et al. Phylogeography of Francisella tularensis subsp. holarctica, Europe. Emerg Infect Dis [serial on the Internet]. 2012 Feb [date cited]. Epub 2012 Jan 4. http://dx.doi.org/10.3201/eid1802.111305

These authors contributed equally to this article.

Acknowledgments

We thank Talima Pearson for helpful discussions and Megan Shuey for technical assistance with whole-genome sequencing.

This work was supported in part by the US Department of Homeland Security Science and Technology Directorate through awards HSHQDC-10-C-00139 and 2010-ST-108-000015.

Isolates in study of the phylogeography of <italic>Francisella tularensis</italic> subsp. <italic>holarctica</italic>, Europe*
ID no.†Original ID no.‡Originating laboratoryCountry of originSource§YearSubclade from (5)¶#Subclade from (8)¶ **Subclade from this study¶
F0586AF19BIMAustriaLepus europaeus199713/1420/2133/34
F0587AF9BIMAustriaL. europaeus199613/1420/2133/34
F0589AF6BIMAustriaL. europaeus199413/1420/2133/34
F0590AF5BIMAustriaL. europaeus199713/1420/2133/34
F0591AF3BIMAustriaL. europaeus199713/1420/2133/34
F0599AF22BIMAustriaL. europaeus199713/1420/2133/34
F0595AF54BIMAustriaL. europaeus199413/1420/2134/35
F0597AF36BIMAustriaHuman199713/1420/2134/35
F0588AF8BIMAustriaL. europaeus199513/1420/2136/37
F0614DF161BIMGermanyHuman200713/1420/2133/34
F0616DF159BIMGermanyL. europaeus200713/1420/2133/34
F0620DF155BIMGermanyHuman200713/1420/2133/34
F0626DF163BIMGermanyHuman200713/1420/2133/34
F0627DF162BIMGermanyHuman200713/1420/2133/34
F0634DF170BIMGermanyL. europaeus200713/1420/2133/34
F0639DF193BIMGermanyL. europaeus200813/1420/2133/34
F0640DF194BIMGermanyL. europaeus200813/1420/2133/34
F0641DF195BIMGermanyL. europaeus200813/1420/2133/34
F0642DF196BIMGermanyL. europaeus200813/1420/2133/34
F0643DF197BIMGermanyL. europaeus200813/1420/2133/34
F0601DF101BIMGermanyMacaca fascicularis200213/1420/2134/35
F0603DF99BIMGermanyM. mulatta200513/1420/2134/35
F0611DF107BIMGermanyM. fascicularis200513/1420/2134/35
F0617DF158BIMGermanyL. europaeus200713/1420/2134/35
F0621DF169BIMGermanyL. europaeus200713/1420/2134/35
F0625DF164BIMGermanyL. europaeus200713/1420/2134/35
F0704T1SZIUHungaryL. europaeus200713/1423/14/2523/14/25
F0713T17SZIUHungaryL. europaeus200813/1420/2120/21/33
F0714T19SZIUHungaryL. europaeus200813/1420/2120/21/33
F0702TM1SZIUHungaryChlorocebus aethiops200313/1420/2133/34
F0703TM2SZIUHungaryErythrocebus patas200313/1420/2133/34
F0705T3SZIUHungaryL. europaeus200713/1420/2133/34
F0706T4SZIUHungaryL. europaeus200713/1420/2133/34
F0707T6SZIUHungaryL. europaeus200713/1420/2133/34
F0709T11SZIUHungaryL. europaeus200713/1420/2133/34
F0710T12SZIUHungaryL. europaeus200713/1420/2133/34
F0711T13SZIUHungaryL. europaeus200713/1420/2133/34
F0712T14SZIUHungaryL. europaeus200813/1420/2133/34
F0716T22SZIUHungaryL. europaeus200813/1420/2133/34
F0715T21SZIUHungaryL. europaeus200813/1420/2134/35
F0708T7SZIUHungaryL. europaeus200713/1420/21TUL07/2007
F073242055/2008IZSLERItalyNatural spring water2008FTNF002–00FTNF002–00FTNF002–00
F073321851/2006IZSLERItalyL. europaeus2006FTNF002–00FTNF002–00FTNF002–00
F07345768/2001IZSLERItalyHuman2001FTNF002–00FTNF002–00FTNF002–00
F07318660/1995IZSLERRomania/ ItalyL. europaeus199513/1420/2133/34
F0433Fr014AFSSACentral Europe††L. europaeusUNK13/1420/2133/34
F0459Fr040AFSSACentral EuropeL. europaeusUNK13/1420/2137/38
F0188FSC 181SDRACzech RepublicDermacentor reticulatus199513/1420/2133/34
F0190FSC 183SDRACzech RepublicD. reticulatus199513/1420/2133/34
F0191FSC 184SDRACzech RepublicD. reticulatus199513/1420/2133/34
F0193FSC 186SDRACzech RepublicD. reticulatus199513/1420/2133/34
F0194FSC 187SDRACzech RepublicIxodes ricinus199513/1420/2133/34
F0187FSC 180SDRACzech RepublicD. reticulatus199513/1420/2134/35
F0189FSC 182SDRACzech RepublicD. reticulatus199513/1420/2134/35
F0192FSC 185SDRACzech RepublicD. reticulatus199513/1420/2134/35
F0035FSC 080SDRAFinlandL. europaeus198413/1420/2120/21/33
F0163FSC 249SDRAFinlandHuman199513/1420/2120/21/33
F0025FSC 121SDRARussiaWater198513/1420/2120/21/33
F0026FSC 123SDRARussiaWater198313/1420/2120/21/33
F0030FSC 151SDRARussiaWater198813/1420/2120/21/33
F0034FSC 077SDRASwedenL. europaeus198113/1420/2120/21/33
F0040FSC 188SDRASwedenHuman199613/1420/2120/21/33
F0093FSC 102SDRASwedenHuman198113/1420/2120/21/33
F0227FSC 273SDRASwedenHuman200013/1420/2120/21/33
F0302FSC 175SDRASwedenHuman199513/1420/2120/21/33
F0036FSC 081SDRASwedenL. europaeus198513/1420/2133/34
F0226FSC 272SDRASwedenHuman200013/1420/2133/34
F0209FSC 248SDRASwedenHuman200013/1420/2135/36

*ID, identification; BIM, Institut für Mikrobiologie der Bundeswehr; SZIU, Szent István University; IZSLER, Istituto Zooprofilattico Sperimentale della Lombardia e dell’Emilia Romagna; AFSSA, Agence Française de Sécurité Sanitaire des Aliments and Laboratoire d'Etudes et de Recherches en Pathologie Animale et Zoonoses; UNK, unknown; SDRA, Swedish Defense Research Agency.
†Isolate ID in the Northern Arizona University DNA collection.
‡Isolate ID from the originating laboratory.
§Lepus europaeus, European brown hare; Macaca fascicularis, long-tailed macaque; M. mulatta, rhesus monkey; Chlorocebus aethiops, vervet monkey; Erythrocebus patas, patas monkey; Ixodes ricinus, castor bean tick (sheep tick); Dermacentor reticulatus, marsh tick.
¶In the interest of space, subclade names have been truncated to remove the preceding B.Br. nomenclature because all of these subclades belong in the B clade of F. tularensis.
#Canonical single nucleotide polymorphism (canSNP) subclade originally defined in (5) and modified as described in the text.
**CanSNP subclade defined in (8). These names have been modified to conform to the nomenclature standard originally established by (5) and modified as described in the text.
††Country unknown.

Melt-MAMA primers targeting canonical SNPs for 6 new phylogenetic branches in a study of <italic>Francisella tularensis</italic> subsp. <italic>holarctica</italic>, Europe*
SNPSCHU† S4 positionSNP state, D/A‡Primers, 5′ → 3′§Con, µM¶Tm, °C
B.3378,382T/CA: ATTGCTACTTCTATTTACGCCAACAG0.2074.3
D: GGGGCGGGGCGGGGCATTGCTACTTCTATTTACGCCAAGAA0.2079.0
C: TGTGAACAACCAAGTTGGCTT0.20
B.34766,614A/GA: GTAGCGAGCATTATTTGCTGGTTC0.4069.2
D: GGGGCGGGGCGGGGCTAGCGAGCATTATTTGCTGGGTT0.2078.6
C: ATAAAACTATAAATTTACATAAAATGAAAACTTCTC0.20
B.35239,479A/CA: GCCTTAATCTAGTATTTTCGCTTATCTCC0.4070.3
D: GGGGCGGGGCGGGGCGCCTTAATCTAGTATTTTCGCTTATCACA0.2075.5
C: CGGGCTCTAAAATAAGATTTAAGTTAGTAAGT0.20
B.361,599,292A/CA: TATTATAGTTTCTAAAAACAGTCTAATTAATTTTG0.6069.0
D: GGGGCGGGGCGGGGCTATTATAGTTTCTAAAAACAGTCTAATTAATTGTT0.2073.9
C: GTTCGACCATGACTACAGTGTTG0.20
B.37318,602T/CA: AACATTTTAGGAACTCTACGATGATAAACTTAAC0.2069.7
D: GGGGCGGGGCGGGGCCATTTTAGGAACTCTACGATGATAAACTTGAT0.2075.9
C: GAAATATCTCAATGAAATCTAATTTAACTAAAATCAC0.20
B.38166,885C/TA: ATGCCATCAGCCATTTACTACTCACA0.2073.7
D: GGGGCGGGGCGGGGCCCATCAGCCATTTACTACTCCCG0.2080.1
C: CTTCCCTGATTTTCTAAGTTCTGCTTG0.20

*Melt-MAMA, melt-mismatch amplification mutation assay; SNP, single nucleotide polymorphism; con, concentration; Tm, melting temperature for ancestral and derived Melt-MAMA amplification products.
†SCHU strain GenBank accession no. NC_006570.
‡SNP states are presented according to their orientation in the SCHU S4 reference genome (AJ749949.2): D, derived SNP state; A, ancestral SNP state.
§D, derived allele primer; A, ancestral allele primer; C, common primer; primer tails and antepenultimate mismatch bases are in lower case.
¶Final concentration of each primer in Melt-MAMA genotyping assays.

Dr Gyuranecz is a postdoctoral fellow at the Veterinary Medical Research Institute, Hungarian Academy of Sciences, Budapest, Hungary. His primary research interest is zoonotic wildlife diseases.

ReferencesDennis DT, Inglesby TV, Henderson DA, Bartlett JG, Ascher MS, Eitzen E, Tularemia as a biological weapon: medical and public health management. JAMA. 2001;285:276373 10.1001/jama.285.21.276311386933Rotz LD, Khan AS, Lillibridge SR, Ostroff SM, Hughes JM Public health assessment of potential biological terrorism agents. Emerg Infect Dis. 2002;8:22530 10.3201/eid0802.01016411897082Keim P, Johansson A, Wagner DM Molecular epidemiology, evolution, and ecology of Francisella. Ann N Y Acad Sci. 2007;1105:3066 10.1196/annals.1409.01117435120Keim PS, Wagner DM Humans and evolutionary and ecological forces shaped the phylogeography of recently emerged diseases. Nat Rev Microbiol. 2009;7:81321 10.1038/nrmicro221919820723Vogler AJ, Birdsell D, Price LB, Bowers JR, Beckstrom-Sternberg SM, Auerbach RK, Phylogeography of Francisella tularensis: global expansion of a highly fit clone. J Bacteriol. 2009;191:247484 10.1128/JB.01786-0819251856Chanturia G, Birdsell DN, Kekelidze M, Zhgenti E, Babuadze G, Tsertsvadze N, Phylogeography of Francisella tularensis subspecies holarctica from the country of Georgia. BMC Microbiol. 2011;11:139 10.1186/1471-2180-11-13921682874Pilo P, Johansson A, Frey J Identification of Francisella tularensis cluster in central and western Europe. Emerg Infect Dis. 2009;15:204951 10.3201/eid1512.08080519961699Svensson K, Granberg M, Karlsson L, Neubauerova V, Forsman M, Johansson A A real-time PCR array for hierarchical identification of Francisella isolates. PLoS ONE. 2009;4:e8360 10.1371/journal.pone.000836020027310Vogler AJ, Birdsell DN, Lee J, Vaissaire J, Doujet CL, Lapalus M, Phylogeography of Francisella tularensis ssp. holarctica in France. Lett Appl Microbiol. 2011;52:17780 10.1111/j.1472-765X.2010.02977.x21214606