Emerg Infect DisEmerging Infect. DisEIDEmerging Infectious Diseases1080-60401080-6059Centers for Disease Control and Prevention22000397331064710-139910.3201/eid1710.101399Letters to the EditorLetterNovel Hepatitis E Virus Genotype in Norway Rats, GermanyNovel HEV in Norway RatsZhangWenShenQuanHuaXiuguoCuiLiJiangsu University, Jiangsu, People’s Republic of China (W. Zhang);The Ohio State University, Wooster, Ohio, USA (Q. Shen);Shanghai JiaoTong University, Shanghai, People’s Republic of China (X. Hua, L. Cui)Address for correspondence: Li Cui, School of Agriculture and Biology, Shanghai JiaoTong University, 800 Dongchuan Rd, Shanghai 200240, People’s Republic of China; email: lcui@sjtu.edu.cn102011171019811982Keywords: hepatitis E virusvirusesGermanyratslettergenotypeNorwayHEV

To the Editor: We read with interest the article by Johne et al. about 2 novel hepatitis E virus (HEV) isolates in Norway rats in Germany (1). Some points in the report deserve comment.

First, because of degeneracy of the genetic code, HEV amino acid sequences are more conserved than nucleotide sequences. For instance, although the open reading frame 2 of the avian HEV isolate (GenBank accession no. AY535004) has only 65% nt sequence homology to that of the swine HEV isolate swGX32 (GenBank accession no. EU366959), their amino acid sequences shared >90% identity. However, the table in (1) indicated the amino acid sequence homologies between the novel and previous HEV isolates were similar to (some even lower than) the nucleotide sequence homologies. These low sequence identities of the capsid proteins between the novel and previous HEVs may explain why no HEV antibody–positive rat was found in the initial serologic screening with a commercial genotype 1–based ELISA. Furthermore, we wonder how the novel antigen in the hepatocytes could react with the anti-HEV serum in the immunohistochemical staining.

Second, the authors stated they determined the entire virus genome by using a previously described method (2). The primers in that method were designed to amplify a genotype 3 HEV isolate with low (55.7%) sequence homology to the 2 novel HEV isolates and therefore cannot amplify their sequences. We ask the authors to list the new primer sequences they used, which will help determine the full viral genome if this virus is found in other regions or animal species.

Suggesting the rabbit HEV sequences may be representative genotype 3 isolates is not yet appropriate because not enough research has yet determined whether rabbit HEV infects other species. Therefore, the rabbit HEV sequence FJ906895 should not be listed as representative genotype 3 isolate as in Figure 1 in (1). Also, the swine isolate DQ450072 should not be listed as a representative genotype 4 isolate; a recent report indicated it was a recombinant produced between genotypes 3 and 4 isolates (3).

Suggested citation for this article: Zhang W, Shen Q, Hua X, Cui L. Novel hepatitis E virus genotype in Norway rats, Germany [letter]. Emerg Infect Dis [serial on the Internet]. 2011 Oct [date cited]. http://dx.doi.org/10.3201/eid1710.101399

This work was supported by the Professional Research Foundation for Advanced Talents of Jiangsu University under grant no.10JDG059 and a grant from the National Natural Science Foundation of China no. 31070132.

ReferencesJohne R, Heckel G, Plenge-Bönig A, Kindler E, Maresch C, Reetz J, Novel hepatitis E virus genotype in Norway rats, Germany. Emerg Infect Dis. 2010;16:1452–5 10.3201/eid1609.10044420735931Schielke A, Sachs K, Lierz M, Appel B, Jansen A, Johne R Detection of hepatitis E virus in wild boars of rural and urban regions in Germany and whole genome characterization of an endemic strain. Virol J. 2009;6:58 10.1186/1743-422X-6-5819442307Wang H, Zhang W, Ni B, Shen H, Song Y, Wang X, Recombination analysis reveals a double recombination event in hepatitis E virus. Virol J. 2010;7:129 10.1186/1743-422X-7-12920546601Emerg Infect DisEmerging Infect. DisEIDEmerging Infectious Diseases1080-60401080-6059Centers for Disease Control and PreventionDOI: 10.3201/eid1710.110283ArticleJohneReimarHeckelGeraldDremsekPaulPlenge-BönigAnitaKindlerEvelineMareschChristinaReetzJochenSchielkeAnikaUlrichRainer G.Federal Institute for Risk Assessment, Berlin, Germany (R. Johne, J. Reetz, A. Schielke);Swiss Institute of Bioinformatics, Genopode, Lausanne, Switzerland (G. Heckel);University of Bern, Bern, Switzerland (G. Heckel, E. Kindler);Friedrich-Loeffler-Institut, Greifswald–Insel Riems, Germany (P. Dremsek, C. Maresch, R.G. Ulrich);Institute of Hygiene and Environment Hamburg, Hamburg, Germany (A. Plenge-Bönig);Free University of Berlin, Berlin, Germany (A. Schielke)Address for correspondence: Rainer G. Ulrich, Friedrich-Loeffler-Institut, Federal Research Institute for Animal Health, OIE Collaborating Centre for Zoonoses in Europe, Institute for Novel and Emerging Infectious Diseases, Südufer 10, D-17493 Greifswald–Insel Riems, Germany, email: rainer.ulrich@fli.bund.de

In Response: The major objective of our study was determination and initial characterization of the entire nucleotide sequence of a novel hepatitis E virus (HEV) from Norway rats. We demonstrated high levels of nucleotide and amino acid sequence divergence between HEV strains from the novel rat and other mammalian and avian HEV strains. In line with our data, nucleotide (and amino acid) sequence identities of 50%–53% (42%–49%), 51%–57% (42%–55%), and 45%–46% (20%–29%) were reported for open reading frame (ORF) 1, ORF-2, and ORF-3, respectively, between rat, human, and avian HEV strains (1). Of course, the genetic code is degenerated; however, no strict relationship exists between divergence in nucleotide and corresponding amino acid sequences, e.g., because of natural selection processes (2). We could not reproduce the high level (>90%) of amino acid sequence identity between the capsid protein (CP) of avian HEV (GenBank accession no. AY535004) and the unpublished GenBank entry swGX32 (accession no. EU366959) claimed by Zhang et al. (3).

The low level of amino acid sequence identity between rat and human HEV strains might explain the lack of reactivity of transudates from 6 investigated rats in the genotype 1–based ELISA. Consistent with this assumption, a rat hyperimmune serum specimen, raised against a truncated recombinant rat HEV CP derivative, reacted strongly with the homologous antigen but weakly with genotype 3 HEV antigen (P. Dremsek and R.G. Ulrich, unpub. data). Nevertheless, conserved and cross-reactive epitopes have been identified in the CP of HEV (4) and can be expected in the antigenic protruding domain of rat HEV CP (5). Therefore, some cross-reacting antibodies might exist that would explain detection of rat HEV by the human anti-HEV serum used in immunohistochemical staining.

For sequencing, novel primers were designed (Table). The recombinant nature of strain DQ450072 was not known at time of analysis. Nevertheless, that this sequence clusters near, but not within, the genotype 4 branch is consistent with the reported recombination event.

Primers used in study (<italic>1</italic>) of amplification of complete genome sequence of rat HEV from rat sample 63, Germany*
DesignationBinding positionSequence† (5′ → 3′)
rHEV-RACEn‡307–284GTGCTCATTAATAGATCGAGGGTG
rHEV-RACE‡336–313GGAAGAAAACATCTGTGAATGACA
HEV-100s78–102CGGCCAATTCCGCCYTGGSRAATGC
rHEV-900as905–881TATGCCCGCCCGCACTAAACAAACT
HEV-800s776–801GTGCGGGCCATTGGCTGYCAYTTTGT
rHEV3300as3099–3074AGCCGCCATTCTGTTGGCTCCAGATT
rat5-s2921–2943CGCCGGGTTGTGATKGAYGAGGC
rHEV-td1-as4062–4037GAAATGCCCTGCCCGACCTTGCCATG
HEV-cs3977–3999TCGCGCATCACMTTYTTCCARAA
HEV-cas4446–4424GCCATGTTCCAGACDGTRTTCCA
Rat HEV-inv-s4301–4322GGGGCRCCYGAGTGGATGTGGA
63-5400as5449–5428CTCAGTCGCCATGATATGCGTA
#8-ORF2-s5399–5421CCCTTACTGCCTYTKCAGGAYGG
#8-ORF2-as5604–5582GTGGAAGTGATGGAATTCATRTC
63-5500s§5555–5576CAATCCACAACAGTCCCCACGT

*HEV, hepatitis E virus; RACE, rapid amplification of cDNA ends; ORF, open reading frame.
†D = A + G + T; K = G + T ; M = A + C; R = A + G; S = G + C; Y = C + T.
‡Primers were used for 5′-RACE.
§Primer was used for 3′-RACE.

Virus taxonomy has to “categorize the multitude of known viruses into a single classification scheme that reflects their evolutionary relationships” (6). Because the evolutionary relationships could not be determined without sequence analyses, we could not follow the suggestion of Zhang et al. to use other than genetic information for genotype classification (3). Future classification of HEV strains would profit from definition of solid criteria and distinct thresholds for definition of genotypes.

Suggested citation for this article: Johne R, Heckel G, Dremsek P, Plenge-Bönig A, Kindler E, Maresch C, et al. Novel hepatitis E virus genotype in Norway rats, Germany [letter]. Emerg Infect Dis [serial on the Internet]. 2011 Oct [date cited]. http://dx.doi.org/10.3201/eid1710.110283

ReferencesBatts W, Yun S, Hedrick R, Winton J A novel member of the family Hepeviridae from cutthroat trout (Oncorhynchus clarkii). Virus Res. 2011;158:116–23 10.1016/j.virusres.2011.03.01921458509Holmes EC The evolution and emergence of RNA viruses. Oxford series in ecology and evolution. Oxford (UK): Oxford University Press; 2009Zhang W, Shen Q, Hua X, Cui L Novel hepatitis E virus genome in Norway rats, Germany. Emerg Infect Dis. 2011;17:1981–222000397Haqshenas G, Huang FF, Fenaux M, Guenette DK, Pierson FW, Larsen CT, The putative capsid protein of the newly identified avian hepatitis E virus shares antigenic epitopes with that of swine and human hepatitis E viruses and chicken big liver and spleen disease virus. J Gen Virol. 2002;83:2201–912185274Johne R, Plenge-Bönig A, Hess M, Ulrich RG, Reetz J, Schielke A Detection of a novel hepatitis E-like virus in faeces of wild rats using a nested broad-spectrum RT-PCR. J Gen Virol. 2010;91:750–8 10.1099/vir.0.016584-019889929Ball LA The universal taxonomy of viruses in theory and practice. In: Fauquet CM, Mayo MA, Maniloff J, Desselberger U, Ball LA, editors. Virus taxonomy. Eighth report of the ICTV. San Diego (CA): Elsevier Academic Press; 2005 p. 3–8.