Emerg Infect DisEIDEmerging Infectious Diseases1080-60401080-6059Centers for Disease Control and Prevention21392449316600310-089410.3201/eid1703100894DispatchPhylogeny of European Bat Lyssavirus 1 in Eptesicus isabellinus Bats, SpainEuropean Bat Lyssavirus 1 in Eptesicus isabellinus BatsVázquez-MorónSoniaJusteJavierIbáñezCarlosBercianoJosé M.EchevarríaJuan E.Author affiliations: Instituto de Salud Carlos III, Majadahonda, Madrid, Spain (S. Vázquez-Morón, J.M. Berciano, J.E. Echevarría);Centro de Investigación Biomédica de Epidemiología y Salud Pública, Barcelona, Spain (S. Vázquez-Morón, J.E. Echevarría);Consejo Superior de Investigaciones Científicas Estación Biológica de Doñana, Seville, Spain (J. Juste, C. Ibáñez)Address for correspondence: Sonia Vázquez-Morón, Diagnostic Microbiology Service, National Center for Microbiology, Instituto de Salud Carlos III, Carretera de Majadahonda-Pozuelo Km 2, Majadahonda 28220, Madrid, Spain; email: svazquez@isciii.es32011173520523

To better understand the epidemiology of European bat lyssavirus 1 (EBLV-1) in Europe, we phylogenetically characterized Lyssavirus from Eptesicus isabellinus bats in Spain. An independent cluster of EBLV-1 possibly resulted from geographic isolation and association with a different reservoir from other European strains. EBLV-1 phylogeny is complex and probably associated with host evolutionary history.

LyssavirusbatsphylogenyrabiesEBLV-1Eptesicus isabellinusvirusesSpaindispatch

The genus Lyssavirus comprises 3 species that can infect bats in Europe: European bat lyssavirus 1 (EBLV-1), European bat lyssavirus 2, and West-Caucasian bat virus (1,2). Most lyssavirus-infected bats have been found in north-central Europe (Germany, the Netherlands, Denmark, Poland, and France); of these, >95% were serotine bats (Eptesicus serotinus) infected by EBLV-1 (35). EBLV-1 in other bat species has rarely been described (3,6). EBLV-1–infected bats become increasingly scarce from north to south in Europe, and no cases in northern Spain or Italy have been reported. The same trend has been consistently found within Germany (3) except for an artifact that arose from varied surveillance intensity among different countries. However, several infected serotine bats in southern Spain have been reported (7). These bats have been assigned to the species E. isabellinus, which has closely related populations on the African side of the Gibraltar Strait (8). This species is strongly divergent from E. serotinus bats (>16% of cytochrome b gene) in the northern Iberian Peninsula (9). In Spain, the distribution of EBLV-1 cases in bats apparently coincides with the distribution of E. isabellinus bats; 10 cases of human exposure after contact with infected bats have been reported; each was associated with E. isabellinus bats.

Two subtypes have been proposed for EBLV-1: EBLV-1a, which extends from the Netherlands to Russia in a west–east axis, and EBLV-1b, which includes strains that extend south through France and the Netherlands and the only 2 published strains from Iberia (1). We phylogenetically characterized EBLV-1 strains associated with E. isabellinus bats, a reservoir in the Iberian Peninsula that differs from E. serotinus bats.

The Study

We sequenced 12 bat brains positive for Lyssavirus antigen detected by immunofluorescence and reverse transcription–PCR (RT-PCR) as described (10). All viruses were identified as EBLV-1. For phylogenetic analyses, the 400-bp 5′ variable extreme of the nucleoprotein gene of these EBLV-1 strains was amplified by specific EBLV-1 nested RT-PCR and sequenced by using the following primers: SEQVAR1F 5′-1ACGCTTAACAACCAGATCAAAG22-3′, SEQVAR2F 5′-51AAAAATGTAACACYYCTACA70-3′, EBLVSEQVAR1R 5′-596CAGTCTCAAAGATCTGTTCCAT575-3′, and EBLVSEQVAR2R 5′-552TAGTTCCCAGTATTCTGTCC533-3′.

All rabies-positive serotine bats came from southern Spain (Huelva, Seville, Murcia, and Badajoz) and were molecularly identified as E. isabellinus (8). An alignment was performed by using ClustalX (www.clustal.org) to combine the obtained sequences and other available EBLV-1 sequences from GenBank, including a Duvenhage virus used as the outgroup (Table A1). Before conducting further analyses, we used jModelTest (http://darwin.uvigo.es/software/jmodeltest.html) to select the best fitting substitution model for our sequences according to the corrected Akaike information criterion. Maximum-likelihood phylogenies were reconstructed by using PHYML (http://atgc.lirmm.fr/phyml) software and by using a generalized time-reversible model and the γ parameter estimated in the analyses. Maximum-parsimony analyses were conducted by using PAUP* 4.0b10 (http://paup.csit.fsu.edu/) weighting transversions 15× according to the transitions/transversion ratio estimated in the jModelTest analyses. Confidence in the topologies for the maximum-likelihood and the maximum-parsimony analyses was established with 1,000 bootstrap replicates. A Bayesian phylogenetic inference was obtained by using MrBayes version 3.1 (http://mrbayes.csit/fsu.edu/) with random starting trees without constraints. Two simultaneous runs of 107 generations were conducted, each with 4 Markov chains, and the trees were sampled every 100 generations. Net p-distances between groups were calculated by using MEGA4 (www.megasoftware.net) (Figure 1).

European bat lyssavirus 1 (EBLV-1) phylogenetic reconstruction based on the first 400 bp of the nucleoprotein gene. The tree was obtained by Bayesian inference run for 107 generations; trees were sampled every 100 generations. The first 25% of trees were excluded from the analysis as burn-in. Black numbers indicate posterior probabilities. Bootstrap supports after 1,000 replicates for each node are also shown for maximum-parsimony (green numbers) and maximum-likelihood (blue numbers) analyses. Net p-distance values (as percentages) between groups are indicated by arrows. A parsimony-based network is presented for each major lineage; sizes of yellow circles are proportional to the number of individuals sharing a given haplotype, and reconstructed haplotypes (median vectors) are shown in red. DUVV, Duvenhage virus.

The genetic structure and relationships between haplotypes were examined within the main lineages through a parsimony-based network built with a median-joining algorithm implemented in the Network 4.5.1 program (11). To evaluate and compare genetic variability and polymorphism among lineages, we estimated the number of haplotypes, mutations, and segregating sites as well as haplotype diversity and nucleotide diversity by using DNAsp version 4.5 (12) for the major clades (Table). Finally, to investigate population dynamics across lineages, the Fu Fs and Tajima D statistics were calculated (Table). These 2 statistics are considered to be the most powerful tests for detecting expansion events (13).

. Genetic diversity statistics for EBLV-1*
PopulationnSEtaHapHdVarHdPiThetaNuckTajima DFu Fs
EBLV-1a524548260.8360.002670.006640.026562.6546–2.5693
(0.00000)–21.676
(0.00000)
EBLV-1b253535180.9700.000380.022020-023178.8067–0.1885
(0.48000)–4.555
(0.05100)
EBLV-1Spain139970.7950.011910.005380.007252.1538–1.0138
(0.18100)–2.067
(0.06143)

*EBLV, European bat lyssavirus; n, no. sequences; S, no. segregating sites; Eta, no. mutations; Hap, no. haplotypes; Hd, haplotype diversity; VarHd, haplotype variance; Pi, nucleotide diversity; ThetaNuc, estimated population mutation rate per site; k, average no. nucleotide differences; and neutrality tests (Tajima D and Fu Fs).

Conclusions

All phylogenetic analyses, regardless of the reconstruction criterion used, formed a monophyletic cluster of the EBLV-1 strains from Spain (only the Bayesian inference reconstruction is shown). The Bayesian inference, maximum-likelihood, and maximum-parsimony analyses identified the cluster from Spain and EBLV-1a and EBLV-1b as being monophyletic (Figure 1), although only maximum-likelihood and maximum-parsimony analyses suggested a closer relationship between EBLV-1a and the cluster from Spain. The genetic differentiation of the EBLV-1 strains from the Iberian Peninsula matches their association with another bat species (Figure 2), which suggests that the host bat’s evolutionary history plays a major role in EBLV-1 molecular epidemiology, as has been proposed for rabies virus in bats in North America (14).

Geographic distribution of Eptesicus serotinus bats (red), E. isabellinus bats (blue), and cases of rabies in bats (green dots), Europe, 1990–2009. Obtained from Rabies Bulletin Europe (www.who-rabies-bulletin.org/).

The low genetic diversity and the Fu Fs and Tajima D statistics (Table) all suggest rapid population expansion of EBLV-1a, which is consistent with the star-like structure of the network for this lineage (Figure 1). Conversely, haplotype and nucleotide diversity descriptors (Table) have the highest values for EBLV-1b and a complex network structure with differentiated subnetworks. All these elements indicate that this lineage has a complex evolutionary history. The lineage from Spain also has low diversity and a star-shaped network, but neutral evolution cannot be rejected on the basis of the Fs and D statistics. Net distances are similar within and between lineages, except for EBLV-1a, which is slightly more differentiated (Figure 1). Consequently, the suggested EBLV-1 expansion from Spain into Europe (15) is not supported by our results, which record the highest variability and most complex phylogenetic structure for France and the Netherlands (Figure 1). This complex structure suggests either a longer evolutionary history in these areas or a recent contact of distinct bat lineages in this zone.

The results of this study show that the strains from Spain do not belong to subtype 1b because of their association with a different reservoir (E. isabellinus bats). Moreover, what is currently considered to be EBLV-1b seems to include at least 4 lineages that are more genetically diverse and have a complex history. EBLV-1a, however, has low genetic diversity despite its extensive geographic distribution, suggesting a relatively recent and successful expansion of this lineage. These results call into question the current classification of EBLV-1 into 2 single subtypes. To provide a better understanding of EBLV-1 molecular epidemiology in Europe, additional studies that consider different genes should be conducted and the current classification should be revised accordingly.

Suggested citation for this article: Vázquez-Morón S, Juste J, Ibáñez C, Berciano JM, Echevarría JE. Phylogeny of European bat lyssavirus 1 in Eptesicus isabellinus bats, Spain. Emerg Infect Dis [serial on the Internet]. 2011 Mar [date cited]. http://dx.doi.org/10.3201/eid1703100894

Acknowledgments

We thank the Genomics Unit of the Instituto de Salud Carlos III for analyses of the genomic sequences and Enrique Royuela Casamayor for his involvement in the daily work.

This project was financially supported by an agreement between the Public Health Department of the Spanish Ministry of Health and the Instituto de Salud Carlos III for the development of “Rabies Surveillance in Spain” and by projects SAF 2006-12784-C02-01 and SAF 2006-12784-C02-02 of the General Research Programme of the Spanish Ministry of Science and Education.

EBLV-1 strains used in study of EBLV phylogeny in bats, Spain
GenBank accession no.ID treeVirusStrainVirus sourceYear isolatedCountryNo. haplotypes
AY996324DUVV194286SADUVVMiniopterus sp.1981South AfricaND
DQ222422R76R76EBLV1Eptesicus isabellinus1987Spain45
DQ222421R75R75EBLV1E. isabellinus1989Spain48
DQ222419155R99155R99EBLV1E. isabellinus1999Spain47
DQ22242369R9969R99EBLV1E. isabellinus1999Spain46
DQ22242480R9980R99EBLV1E. isabellinus1999Spain49
DQ2224181241812418EBLV1E. isabellinus2000Spain46
DQ22242069R0069R00EBLV1E. isabellinus2000Spain46
DQ22242544R0244R02EBLV1E. isabellinus2002Spain50
HM212661292R07292R07EBLV1E. isabellinus2007Spain51
HM212662211R07211R07EBLV1E. isabellinus2007Spain46
HM21266486R0886R08EBLV1E. isabellinus2008Spain46
HM2126632845828458EBLV1E. isabellinus2009Spain46
AY0620828268GR9EBLV1aE. serotinus1968Germany12
AY8633484868GR9395GEREBLV1aE. serotinus1968Germany12
AY8633505070GR9398GEREBLV1aE. serotinus1970Germany2
AY8633515182GR9399GEREBLV1aE. serotinus1982Germany2
AY2458454585DKEBLV1a-DUV07EBLV1aE. serotinus1985Denmark2
AY8633494985GR9396GEREBLV1aE. serotinus1985Germany12
AY8633696985PO8615POLEBLV1aE. serotinus1985Poland15
AY8633717185RU9397RUSEBLV1aHomo sapiens1985Russia25
AY8933686885HO02022HOLEBLV1aE. serotinus1985Holland2
AY8633525286GR9436GEREBLV1aE. serotinus1986Germany9
AY8633575786GR9477GEREBLV1aE. serotinus1986Germany13
AY8633535387GR9437GEREBLV1aE. serotinus1987Germany6
AY8633626287HO9480HOLEBLV1aE. serotinus1987Holland2
AY8633727287UC9443UKREBLV1aVespertilio murinus1987Ukraine26
AY8633737387DE9479DENEBLV1aE. serotinus1987Denmark14
AY8633747487DK94110DENEBLV1aE. serotinus1987Denmark2
U894737387DK94109DENEBLV1aE. serotinus1987Denmark2
U894767687HO9474HOLEBLV1aE. serotinus1987Holland17
AY8633545488GR9438GEREBLV1aE. serotinus1988Germany2
AY8633555589GR9440GEREBLV1aE. serotinus1989Germany8
AY8633616189HO9478HOLEBLV1aE. serotinus1989Holland20
AY8633636389HO94116HOLEBLV1aE. serotinus1989Holland2
U894616189GR9439GEREBLV1aE. serotinus1989Germany16
AY8633565690GR9441GEREBLV1aE. serotinus1990Germany2
AY8633585890GR9481GEREBLV1aE. serotinus1990Germany2
AY8633707090PO9394POLEBLV1aE. serotinus1990Poland1
U894646490GR9442GEREBLV1aE. serotinus1990Germany2
AY8633595992HO9366GEREBLV1aE. serotinus1992Holland3
AY8633606092HO9372HOLEBLV1aE. serotinus1992Holland2
U894525292HO9368HOLEBLV1aE. serotinus1992Holland4
U894545493HO9374HOLEBLV1aE. serotinus1993Holland18
U894555594PO96031POLEBLV1aE. serotinus1994Poland5
AY8633757595DK02010DENEBLV1aE. serotinus1995Denmark2
AY8633767697DK02011DENEBLV1aE. serotinus1997Denmark7
AY8633676798HO02021HOLEBLV1aE. serotinus1998Holland21
AY8633666699HO02020HOLEBLV1aE. serotinus1999Holland19
AY8633777799DK02012DENEBLV1aE. serotinus1999Denmark2
AY8633787899DK02013DENEBLV1aE. serotinus1999Denmark2
AY8633646400HO02017HOLEBLV1aE. serotinus2000Holland2
AY8633656500HO02018HOLEBLV1aE. serotinus2000Holland20
AY8633797900DK02015DENEBLV1aE. serotinus2000Denmark11
AY8633828201ES01018SLOEBLV1aE. serotinus2001Slovenia10
AY8633808002DK02016DENEBLV1aOvis aries2002Denmark7
AY8633818103FR03002FRAEBLV1aE. serotinus2003France24
AF12435212435234EBLV1aUnknownUnknownUnknown23
AF124353124353EBL458861EBLV1aUnknownUnknownUnknown22
AF124354124354RV627EBLV1aUnknownUnknownUnknown14
AY06208383XXGR11EBLV1aUnknownUnknownGermany2
AY06208484XXDK19EBLV1aUnknownUnknownDenmark2
AY06208585XXDK20EBLV1aUnknownUnknownDenmark7
AY06208686XXDK24EBLV1aUnknownUnknownDenmark2
AY06208787XXPO66EBLV1aUnknownUnknownPoland2
AY8633939389FR8919FRAEBLV1bE. serotinus1989France41
AY8633838392HO9367HOLEBLV1bE. serotinus1992Holland31
AY8633868692HO94113HOLEBLV1bE. serotinus1992Holland32
AY8633878792HO94115HOLEBLV1bE. serotinus1992Holland33
U894494992HO9414HOLEBLV1bE. serotinus1992Holland34
AY8633848493HO9376HOLEBLV1bE. serotinus1993Holland33
AY8633858593HO9377HOLEBLV1bE. serotinus1993Holland30
AY8633919194SP94285SPAEBLV1bE. serotinus1994Spain45
AY8633949495FR9603FRAEBLV1bE. serotinus1995France40
AY8633959595FR9906FRAEBLV1bE. serotinus1995France39
AY2458414197FR113852EBLV1bE. serotinus1997France27
AY8633898997HO02024HOLEBLV1bE. serotinus1997Holland35
AY2458444498FR116883EBLV1bE. serotinus1998France39
AY8633888899HO02019HOLEBLV1bE. serotinus1999Holland33
AY2458333300FR121653EBLV1bE. serotinus2000France28
AY2458343400FR132EBLV1bE. serotinus2000France43
AY8633969600FR0001FRAEBLV1bE. serotinus2000France43
AY8633979700FR0002FRAEBLV1bE. serotinus2000France37
AY8633989800FR0003FRAEBLV1bE. serotinus2000France38
AY8633999900FR0102FRAEBLV1bE. serotinus2000France29
AY2458373701FR122319EBLV1bE. serotinus2001France42
AY2458424201FR122154EBLV1bE. serotinus2001France27
AY8634000001FR02031FRAEBLV1bE. serotinus2001France42
AY8634010101FR02032FRAEBLV1bE. serotinus2001France36
AY8634020201FR02033FRAEBLV1bE. serotinus2001France27
AY2458323202FR123008EBLV1bE. serotinus2002France44

*EBLV, European bat lyssavirus; ND, not determined.

Dr Vázquez-Morón is a PhD candidate at the Instituto de Salud Carlos III and Complutense University of Madrid. Her main research interests are the epidemiology and public health implications of rabies and emerging viruses in bats.

ReferencesAmengual B, Whitby JE, King A, Cobo JS, Bourhy H Evolution of European bat lyssaviruses. J Gen Virol. 1997;78:2319289292021Botvinkin AD, Poleschuk EM, Kuzmin IV, Borisova TI, Gazaryan SV, Yager P, Novel lyssaviruses isolated from bats in Russia. Emerg Infect Dis. 2003;9:1623514720408Müller T, Johnson N, Freuling CM, Fooks AR, Selhorst T, Vos A Epidemiology of bat rabies in Germany. Arch Virol. 2007;152:27388 10.1007/s00705-006-0853-517066249Van der Poel WH, Van der Heide R, Verstraten ER, Takumi K, Lina PH, Kramps JA European bat lyssaviruses, the Netherlands. Emerg Infect Dis. 2005;11:1854916485470Picard-Meyer E, Barrat J, Tissot E, Verdot A, Patron C, Barrat MJ, Bat rabies surveillance in France, from 1989 through May 2005. Dev Biol (Basel). 2006;125:283816878486Serra-Cobo J, Amengual B, Abellan C, Bourhy H European bat lyssavirus infection in Spanish bat populations. Emerg Infect Dis. 2002;8:41320 10.3201/eid0804.01026311971777Vázquez-Morón S, Juste J, Ibáñez C, Ruiz-Villamor E, Avellón A, Vera M, Endemic circulation of European bat lyssavirus type 1 in serotine bats, Spain. Emerg Infect Dis. 2008;14:12636 10.3201/1408.08006818680651Juste J, Bilgin R, Muñoz J, Ibáñez C Mitochondrial DNA signatures at different spatial scales: from the effects of the Straits of Gibraltar to population structure in the meridional serotine bat (Eptesicus isabellinus). Heredity. 2009;103:17887 10.1038/hdy.2009.4719401715Ibáñez C, Garcia-Mudarra JL, Ruedi M, Stadelmann B The Iberian contribution to cryptic diversity in European bats. Acta Chiropt. 2006;8:27797 10.3161/1733-5329(2006)8[277:TICTCD]2.0.CO;2Vázquez-Morón S, Avellón A, Echevarría JE RT-PCR for detection of all seven genotypes of Lyssavirus genus. J Virol Methods. 2006;135:2817 10.1016/j.jviromet.2006.03.00816713633Bandelt HJ, Forster P, Rohl A Median-joining networks for inferring intraspecific phylogenies. Mol Biol Evol. 1999;16:374810331250Rozas J, Sánchez-DelBarrio JC, Messeguer X, Rozas R, Dna SP DNA polymorphism analyses by the coalescent and other methods. Bioinformatics. 2003;19:24967 10.1093/bioinformatics/btg35914668244Ramos-Onsins SE, Rozas J Statistical properties of new neutrality tests against population growth. Mol Biol Evol. 2002;19:209210012446801Hughes GJ, Orciari LA, Rupprecht CE Evolutionary timescale of rabies virus adaptation to North American bats inferred from the substitution rate of the nucleoprotein gene. J Gen Virol. 2005;86:146774 10.1099/vir.0.80710-015831959Davis PL, Holmes EC, Larrous F, Van der Poel WH, Tjornehoj K, Alonso WJ, Phylogeography, population dynamics, and molecular evolution of European bat lyssaviruses. J Virol. 2005;79:1048797 10.1128/JVI.79.16.10487-10497.200516051841