Avian hepatitis E virus (HEV) has been identified in chickens; however, only 4 complete or near-complete genomic sequences have been reported. We found that the near-complete genomic sequence of avian HEV in chickens from China shared the highest identity (98.3%) with avian HEV from Europe and belonged to avian HEV genotype 3.
Hepatitis E virus (HEV) is a nonenveloped, positive-sense, single-stranded RNA virus. It has 3 open reading frames (ORFs) and a genome size of 7.2 kb (
Avian HEVs have been identified from chickens with big liver syndrome and hepatitis–splenomegaly syndrome. Each syndrome mainly causes increased deaths, reduced egg production, and enlarged liver and spleen (
In May 2009, hepatitis–splenomegaly syndrome affected a flock of 37-week-old broiler breeder hens in Shandong, China. This flock had a history of decreased egg production. Affected chickens had regressive ovaries, extensive necrosis and hemorrhage of the liver, and enlarged liver and spleen. Antibodies against avian HEV ORF2 were detected in 80 of 94 serum samples from the same chicken flock, according to ELISA (
From the bile samples that were positive for the avian HEV ORF2 gene, we used nested RT-PCR with 5 overlapping fragments to amplify the near-complete genomic sequence of avian HEV. Primers were designed on the basis of the other 4 avian HEV near-complete sequences in GenBank (
| Primer* | Sequence, 5′ → 3′† | Position, nt‡ |
|---|---|---|
| F1-1 | CCATGCCAGGGTAAGAATG | 9–27 |
| R1-1 | AAAACAGCAAGGACCTCC | 1872–1889 |
| F1-2 | CCAGGGTAAGAATGGACG | 14–31 |
| R1-2 | TAATCCAGGTGGCGAGC | 1308–1324 |
| F2-1 | CACTGTGGGTAACATTGTGGC | 1071–1091 |
| R2-1 | GTTCGACTGCTTAGCCACCTG | 2935–2955 |
| F2-2 | AGGCGGAACACGCACAGCA | 1214–1232 |
| R2-2 | TCGTCCACAATGACCCTGC | 2624–2642 |
| F3-1 | GGCTGTGTGGCATGTTCCA | 1985–2003 |
| R3-1 | GGTAAAGAGCCACCATCCAAT | 4010–4030 |
| F3-2 | CCGTGATGGTGACTTGTTGGTTGT | 2262–2285 |
| R3-2 | GGCACATCTCCGCATACTC | 3586–3604 |
| F4-1 | CCCTTCAACATTGGAGTATGC | 3573–3593 |
| R4-1 | ATCTGGTACCGTGCGAGT | 4899–4916 |
| F4-2 | ACATTGGAGTATGCGGAGATG | 3580–3600 |
| R4-2 | TTGAGCGCTCCACTGGGCT | 4820–4838 |
| F5 | GACAATTCAGCCCAGTGGA G | 4809–4828 |
| AUAP§ | GACTCGAGTCGACATCG A | Nonviral |
| AP§ | GACTCGAGTCGACATCGA (T)17 | Nonviral |
*Primers F1-1 to R1-2, F2-1 to R2-2, F3-1 to R3-2, and F4-1 to R4-2 were used to amplify the first, second, third, and fourth fragment of the near-complete avian hepatitis E virus (HEV) genome. Primers F5, amplification primer (AUAP), and adapter primer (AP) were used to amplify the extreme 3′ genomic sequence. Primers R1-1, R2-1, R3-1, R4-1, and AP are also reverse transcription primers. †Sequences of primers were designed according to the sequences of 4 other known avian HEV strains. ‡Positions of primers located in the complete genome are shown according to the Europe avian HEV isolate. §Commercial primer (Invitrogen, Carlsbad, CA, USA) of nonviral origin.
We assembled the near-complete genome of avian HEV, which was 6,660 nt long including the 3′ poly A tail, by using 5 overlapping fragments sequences and Lasergene 7.0 EditSeq computer programs (DNAStar, Madison, WI, USA) and designated it China avian HEV (CaHEV). CaHEV contained a complete ORF1 gene encoding a nonstructural protein of 1,522 aa, an ORF2 gene encoding a capsid protein of 606 aa, an ORF3 gene encoding a cytoskeleton-associated phosphoprotein of 87 aa, and a 3′ noncoding region of 121 nt. The sequences of CaHEV were deposited into GenBank under accession no. GU954430.
The near-complete genomic and different region sequence analyses performed by using ClustalW (
| Sequence and strain | “Avirulent aHEV” | Prototype aHEV | AaHEV | EaHEV | CaHEV |
|---|---|---|---|---|---|
| Near-complete genome sequence | |||||
| “Avirulent aHEV” | 90.1 | 82.7 | 82.9 | 82.6 | |
| Prototype aHEV | 82.5 | 82.2 | 82.0 | ||
| AaHEV | 82.5 | 82.4 | |||
| EaHEV | 98.3 | ||||
| CaHEV | |||||
| ORF1 | |||||
| “Avirulent aHEV” | 89.6 | 82.1 | 81.8 | 81.7 | |
| Prototype aHEV | 81.6 | 81.0 | 80.7 | ||
| AaHEV | 81.7 | 81.6 | |||
| EaHEV | 98.3 | ||||
| CaHEV | |||||
| ORF2 | |||||
| “Avirulent aHEV” | 90.7 | 84.5 | 84.0 | 84.1 | |
| Prototype aHEV | 84.3 | 84.4 | 84.5 | ||
| AaHEV | 84.1 | 84.4 | |||
| EaHEV | 98.5 | ||||
| CaHEV | |||||
| ORF3 | |||||
| “Avirulent aHEV” | 97.0 | 95.4 | 93.6 | 93.9 | |
| Prototype aHEV | 95.4 | 93.6 | 93.9 | ||
| AaHEV | 93.5 | 93.9 | |||
| EaHEV | 98.9 | ||||
| CaHEV | |||||
| 3′ NCR | |||||
| “Avirulent aHEV” | 92.8 | 82.8 | 88.6 | 89.4 | |
| Prototype aHEV | 83.6 | 85.5 | 86.3 | ||
| AaHEV | 80.5 | 78.9 | |||
| EaHEV | 97.6 | ||||
| CaHEV |
*HEV, hepatitis E virus; ORF, open reading frame; NCR, noncoding region.
ORF1 of CaHEV contained most mutations compared with prototype avian HEV (prototype aHEV); 5, 16, and 29 nonsilent mutations occurred in the methyltransferase, helicase, and RNA-dependent RNA polymerase (RdRp) functional domains, respectively (data not shown). However, only 2 mutations occurred in motif VII of RdRp domain (
Amino acid sequence comparison of motif VII in the open reading frame (ORF) 1 RNA-dependent RNA polymerase (RdRp) region of avian, human, and swine hepatitis E viruses (HEVs) (A), antigenic domain II (B), and antigenic domain IV (C) in the ORF2 region of avian HEV. Residues that are conserved among avian HEV (aHEV) isolates are shown as the consensus above the sequences; residues that are conserved in the HEV strains are not shown. GenBank accession numbers of human and swine HEV (sHEV) strains are M73218 (Burma), AF076239 (Hyderabad), D11092 (China Xingjiang), M74506 (Mexico), AF082843 (prototype sHEV), FJ527832 (China Shanghai), AB291955 (Japan Shinagawa), AJ272108 (China T1), AB480825 (Japan HE-JF5), and FJ763142 (Korea). GenBank accession numbers of avian HEV strains are EF206691 (“avirulent aHEV” from the United States), AM535004 (prototype aHEV from the United States), AM943647 (aHEV from Australia [AaHEV]), AM943646 (aHEV from Europe [EaHEV]), and GU954430 (aHEV from China [CaHEV]). Boxes indicate mutations of CaHEV compared with different HEV strains.
In the ORF2 region, 6 nonsilent mutations (C4R, R5G, G27S, T42A, T303V, and Q473M) were determined for CaHEV and compared with prototype aHEV. One mutation of Q(473)M, in the antigenic domain II, was seen in EaHEV and in CaHEV (
Phylogenetic trees of the near full-length sequence of avian and mammalian HEV strains were constructed by using the neighbor-joining distance method and Lasergene 7.0 software. A bootstrap test of 1,000 replicates was used to evaluate the reliability of the groups. Avian HEV was segregated into a distinct branch separate from mammalian HEV; according to the genotype separation corresponding to their geographic origin suggested by Bilic et al. (
Phylogenetic trees based on the near-complete genomic sequences of avian hepatitis E virus (HEV) and 10 human and swine HEV isolates. GenBank accession numbers follow the name of HEV strains. The trees were constructed by the neighbor-joining method with 1,000 bootstrap replicates using Lasergene 7.0 (DNAStar, Madison, WI, USA). The length of each pair of branches represents the distance between sequence pairs; the units at the bottom of the tree indicate the number of substitution events.
Avian HEV infection of a chicken flock in Shandong, China, was identified by detection of avian HEV ORF2 antibodies and viral RNA. A near-complete avian HEV genome from the flock was determined, and sequence analysis indicated that this avian HEV strain displayed the highest identity (98.3%) with EaHEV and belonged to avian HEV genotype 3.
Current affiliation: Northwest A&F University, Yangling, People’s Republic of China.
This study was partially funded by the Taishan Scholar project of Shandong Province.
Mr Qin Zhao is a PhD student in the laboratory of “Taishan Scholar” Immunobiology at the College of Veterinary Medicine, Shandong Agricultural University. His research interests are avian HEV pathogenesis and immunology.