In response to the outbreak of pandemic (H1N1) 2009 in Mexico, we conducted an observational study of critically ill patients with this infection in Winnipeg, Canada. The research was approved by the local research ethics board. The study protocol is described in detail (11).

We examined blood samples from 20 patients with laboratory-confirmed pandemic (H1N1) 2009. Average patient age was 40.35 years. Ethnicity was nonwhite for 10 patients, white for 9, and unknown for 1.

Peripheral blood mononuclear cells were stored, and a subset of samples were thawed and resuspended in 200 uL phosphate-buffered saline. Genomic DNA was extracted by using the QIAamp DNA Mini Kit (QIAGEN, Valencia, CA, USA) according to the manufacturer’s instructions. DNA was amplified by using previously reported primers surrounding the 32-bp deletion in the CCR5 gene: 5′ primer, TCATTACACCTGCAGCTCTC; 3′ primer, TGGTGAAGATAAGCCTCAC. Wild-type CCR5 DNA results in a 197-bp product, but the Δ32 allele results in a 165-bp product. The genotype was determined by visual examination of the PCR product and of a known heterozygote used as a control.

The CCR5Δ32 allele was not found in the nonwhite patients, but it was found in 5 of the 9 white patients (Figure); overall allele frequency for white patients was 27.8%. Among the 5 who were heterozygous for the CCR5Δ32 allele, 1 died, 1 remained in the intensive care unit for >1 month, and 3 were discharged.

The outbreak of pandemic (H1N1) 2009 infection in Canada affected primarily young women; a preponderance were nonwhite and they had no major concurrent conditions. Risk factors identified included a history of lung disease or smoking, obesity, hypertension, and diabetes. The frequency of CCR5Δ32 heterozygosity among white populations has been reported to range from 10% to 15% (12,13); we found CCR5Δ32 heterozygosity at a higher than expected frequency (55.5%) among white patients with critical illness caused by pandemic (H1N1) 2009. Although deficiency of the receptor protects against acquisition of HIV, evidence is accumulating to suggest it plays a role in severity of illness caused by flavivirus infections (7,8). In animal models of influenza, CCR5 plays a role in directing CD8+ T cells to the site of infection, and its absence is associated with increased mortality rates (9,10); however, to our knowledge a similar association in humans has not yet been reported. Our observation suggests that CCR5Δ32 is 1 of the factors associated with increased severity of illness among white patients with pandemic (H1N1) 2009. Identifying genetic factors associated with greater risk for illness severity will help explain the unique pathogenesis displayed in the pandemic (H1N1) 2009 outbreak and may have public health implications. Further studies are required to illuminate the role of CCR5 in delivery of immune cells to the site of influenza infection.