We developed a real-time reverse transcription–-PCR that detected 1,164 copies/mL of Crimean-Congo hemorrhagic fever virus per milliliter of serum at 95% probability (probit analysis) and was 100% concordant with nested PCR on 63 samples from 31 patients with confirmed infection. Infected patients who died appeared to have higher viral loads; low viral loads correlated with IgG detection.
Crimean-Congo hemorrhagic fever (CCHF) is a tickborne viral zoonosis that occurs widely in Africa, Asia, and Eastern Europe. It is caused by
Diagnostic assays for CCHF include virus culture, antigen-detection enzyme immunoassay (EIA), antibody-detection EIA, and reverse transcription–PCR (RT-PCR) (
We describe the first real-time RT-PCR that rapidly and reliably detects the global spectrum of clinically relevant virus strains. An extended strategy of probe design was implemented to cover such high variability. Sensitivity was demonstrated by testing virus strain collections from several different Biosafety Level 4 laboratories, essentially covering the full range of global diversity of CCHFV (
Global distribution and phylogenetic relationships of Crimean-Congo hemorrhagic fever virus (CCHFV) strains selected for design and validation of the assay. All strains except those marked with asterisks were tested. Phylogenetic analysis was based on available 450-bp sequences (from the National Center for Biotechnology Information) of CCHFV small (S-) segment and generated by the neighbor-joining method with TreeCon for Windows (version 1.3b; Yves van de Peer, University Konstanz, Germany). Nomenclature of CCHFV clades is based on (
Primers and probes were selected on the basis of an alignment of S segment sequences of 61 CCHFV isolates from all known CCHF-endemic regions worldwide (
Clinical evaluation. Upper panel: plasma viral load over time in 44 samples from 17 patients. Samples from patients who died are marked with a filled square. Lower panel: plasma viral load in relation to antibody status in 16 samples with and 27 samples without detectable immunoglobulin G (IgG) antibodies. Only IgG status was taken as reference because only 2 patients had IgM without IgG. The difference of means between the 2 groups was highly significant (
For real-time PCR, identifying a simple detection probe compatible with all known CCHFV strains was not possible. Therefore, a broad-range probe was formulated on the basis of the observation that the non–Watson/Crick base pair G:T is almost as thermodynamically stable as regular Watson/Crick base pairs, whereas A:C is very unstable (
| Oligonucleotide* | Purpose, concentration in nM | Sequence and label (5′→3′) | Position (U88410)† |
|---|---|---|---|
| RWCF | Forward primer, 600 | CAAGGGGTACCAAGAAAATGAAGAAGGC | 1068–1095 |
| RWCR | Reverse primer, 600 | GCCACAGGGATTGTTCCAAAGCAGAC | 1248–1223 |
| SE01 | Broad-range probe, 100 | FAM-ATCTACATGCACCCTGCTGTGTTGACA-TAMRA | 1172–1198 |
| SE03 | Additional probe, 100 | FAM-ATTTACATGCACCCTGCCGTGCTTACA-TAMRA | 1172–1198 |
| SE0A | Additional probe, 100 | FAM-AGCTTCTTCCCCCACTTCATTGGAGT -TAMRA | 1131–1106 |
For precise evaluation of analytical sensitivity, a series of human plasma samples was spiked with the RNA standard from strain BT-958 in concentrations ranging from 100,000 to 10 copies per mL. Testing was done on 5 replicate reactions per concentration, and probit analysis was conducted as shown in the expanded online version of
Cross-reactivity was excluded by testing DNA or RNA from cultures or high-titered clinical samples containing Dugbe virus, Rift Valley fever virus, Sudan Ebolavirus Gulu, Lassa virus AV, yellow fever virus, dengue virus types 1–4, Japanese encephalitis virus, West Nile virus Uganda, Venezuelan equine encephalitis virus, Sindbis virus, Ross River virus, Epstein-Barr virus, hepatitis C virus, human cytomegalovirus, monkeypox virus, poliomyelitis virus types 1–3, rabies virus RSDD,
The real-time RT-PCR was used to test and quantify 63 serum samples from 31 patients with laboratory-confirmed CCHFV infection; the samples were obtained 1–18 days after symptom onset. All samples had nested RT-PCR results positive for CCHFV (
To our knowledge, this is the first PCR validated with representative CCHFV strains from nearly all regions worldwide where the virus is endemic. High sensitivity enables reliable detection of virus in early stages of the infection, when antibody detection is unreliable or impossible. By eliminating the need for postamplification product processing, real-time RT-PCR enables shortened turnaround times for reporting results, which is critical for deciding on isolation and contact-tracing for suspected case-patients. Quantification of viral load may assist in estimating the patient’s infectivity. It may also assist in predicting the clinical outcome and could be used to monitor viral load in patients receiving ribavirin treatment (
Comparison of 4 standard diagnostic methods with the novel quantitative real-time reverse transcriptase-PCR (qPCR) assay, using primary specimens and quantification of Crimean-Congo hemorrhagic fever viral load*
We are grateful to Britta Liedigk, Beate Becker-Ziaja, and John Chamberlain for excellent technical assistance.
This work was supported by the European Commission (contracts SSPE-CT-2003-502567 and SSPE-CT-2005-022639), the Bundeswehr Medical Service (contract E/B41G/1G309/1A403), and the Federal Office of Civil Protection and Disaster Assistance (contract BBK-F-440-00-1).
Dr Wölfel is a medical microbiologist at the Department of Virology and Rickettsiology of the Bundeswehr Institute of Microbiology in Munich, Germany. He is working in the area of medical defense against biological warfare and terrorism, and his interests include viral hemorrhagic fevers and rickettsial diseases.