We obtained a random sample of 104 human isolates of C. jejuni (fresh and frozen at –70°C in double-strength skim milk) cultured from stool samples from 1999 to 2002 at the University of Alberta Hospital and Provincial Laboratory for Public Health (Microbiology) in Edmonton, Alberta, Canada, for this study. All stool specimens were routinely cultured for enteric pathogens tested according to standard laboratory protocols. Most C. jejuni isolates were from northern Alberta and represented ≈10% of C. jejuni infections in Alberta reported annually to Health Canada. The Health Research Ethics Board (Biomedical Panel) of the University of Alberta approved the protocol for access to human isolates and collection of patient information for this study.

Clinical data were collected by letter or phone from family physicians' offices and emergency medical records and included information on age, sex, place of residence, travel within the last month, coexisting conditions, symptoms (diarrhea, bloody diarrhea, pain, fever, vomiting) and their duration (interval from symptom onset to initial evaluation), hospitalization (if needed), antimicrobial therapy, and complications. Fever was defined as a complaint of fever stated by the patient or a documented temperature of >38°C. Blood in the stool was observed by the patient and reported to the attending physician. The investigators conducting the chart review and laboratory analyses (pVir screening, antimicrobial susceptibility testing) were blinded to each other's data.

Isolates of C. jejuni were spread on brain heart infusion agar (Difco-Becton-Dickinson, Sparks, MD, USA), supplemented with 0.4% yeast extract (Difco), and incubated at 37°C in microaerobic conditions (5% CO₂, 10% H₂, 85% N₂) for 48 h. Isolates were not passaged more than once. All isolates were stored frozen in brain heart infusion broth (Difco) with 20% glycerol at –80°C.

C. jejuni susceptibility was tested by using the disk diffusion method; the following antimicrobial disks (Oxoid, Nepean, Ontario, Canada) were included: tetracycline (30 μg), kanamycin (30 μg), erythromycin (15 μg), chloramphenicol (30 μg), and nalidixic acid (30 μg). All nalidixic acid-resistant isolates were further tested for resistance to ciprofloxacin (1 μg). Susceptibility testing to all antimicrobial agents was carried out on Mueller-Hinton agar plates that were spread with a 0.5 McFarland standard suspension of C. jejuni in phosphate-buffered saline (Sigma, St. Louis, MO, USA) and incubated for 48 h at 37°C under microaerobic conditions. Zones of inhibition were measured as described by Gaudreau and Gilbert (27). Plasmid isolations were performed by using a Qiagen Midi or Mini Plasmid Kit (Qiagen, Mississauga, Ontario, Canada), by alkaline lysis (28) or by a method used for Helicobacter pylori (29). Tetracycline resistance detected by disk diffusion was confirmed by Etest (Oxoid) and conventional agar dilution.

Purified plasmid DNA from C. jejuni clinical isolates was applied to nitrocellulose paper (Osmonics, Westborough, MA, USA) and air dried. Plasmid pMS11EH was used as a negative control, and plasmid DNA isolated from C. jejuni 81-176 was used as a positive control. Plasmid DNA was denatured in 0.5 mol/L NaOH, 0.15 mol/L NaCl for 5 min, neutralized twice in 10 mmol/L Tris-HCl, 0.15 mol/L NaCl, pH 7.5 for 5 min each time, soaked in 2× SSPE solution (20× SSPE consists of 3.0 mol/L NaCl, 0.2 mol/L NaH₂PO₄, and 0.02 mol/L EDTA) for 5 min, air dried, and baked overnight at 65°C.

The cjp5 (virB11) DNA probe was prepared with primers virB11 Fwd (5´ GAACAGGAAGTGGAAAAACTAGC 3´) and virB11 Rev (5´ TTCCGCATTGGGCTATATG 3´) (15) that were used to amplify by polymerase chain reaction (PCR) a 708-bp product from within the cjp5 gene on pVir. Conditions for the PCR were as follows: initial denaturation at 95°C for 1 min, followed by 30 cycles of denaturation (1 min, 95°C), annealing of primers (1 min, 50°C) and primer extension (1 min, 72°C). PCR was performed in a BioRad Gene Cycler (BioRad, Mississauga, Ontario, Canada). The cjp5 PCR product was purified with a PCR purification kit (Qiagen) and eluted with TE (Tris-EDTA) buffer. DNA was denatured after boiling for 5 min, and the tube was then placed directly on ice. A random primers DNA labeling system (Gibco, Burlington, ON) was used to prepare the ³²P-labeled cjp5 DNA probe. The ³²P-labeled cjp5 DNA probe was used immediately in DNA-DNA hybridizations to screen isolated C. jejuni plasmids for the presence of pVir, under the same stringency conditions defined by Bacon and coworkers (15). Hybridizations were performed in a solution consisting of 6× SSC (20× consists of 3.0 mol/L NaCl and 0.3 mol/L sodium acetate), 5× Denhart solution (50× Denhardt solution consists of 1% wt/vol Ficoll 400 (Sigma), 1% wt/vol polyvinylpyrrolidone (Sigma), and 1% wt/vol bovine serum albumin (Sigma, Fraction V), 0.1% sodium dodecyl sulfate (SDS, BioRad) and 100 μg/mL herring sperm DNA (Invitrogen, Burlington, Ontario, Canada). The ³²P-labeled cjp5 DNA probe was added directly to the hybridization solution in the tube, mixed, and incubated overnight (18 h) at 50°C. The probed nitrocellulose paper was washed in 0.5× SSC 4 times, dried, and then exposed to BioMax MS Film (Eastman Kodak Company, Rochester, NY, USA) overnight at –70°C.

Tetracycline-resistance plasmids were identified by a PCR screen for the tet(O) gene on purified plasmid preparations. Primers tet(O) Fwd (5´ GGCGTTTTGTTTATGTGCG 3´) and tet(O) Rev (5´ ATGGACAACCCGACAGAAGC 3´) were used to amplify a 559-bp fragment of the tet(O) gene from isolated C. jejuni plasmid DNA (15,30). PCR conditions were the same as for the cjp5 PCR described above. Gel electrophoresis was used to confirm the presence of an ≈40-kb plasmid.

The transfer of plasmids from C. jejuni clinical isolate 23-51 (containing both a tetracycline-resistance plasmid and pVir) to C. jejuni UA 543 (a nalidixic acid–resistant, tetracycline-susceptible recipient strain with no plasmids) was carried out (23). Suspensions of donor strain 23-51 and UA 543 recipient strains were mixed in ratios of 1:4 and 1:6, centrifuged, and resuspended in 100 μL of Lennox broth (Difco). Mating suspensions were inoculated onto a 0.22-μm Millipore filter (Millipore Corporation, Nepean, Ontario, Canada), placed on brain heart infusion agar, and incubated for 24 h. Cultures were resuspended in 1 mL of phosphate-buffered saline, diluted, and plated onto Mueller-Hinton agar containing 25 μg/mL tetracycline and 50 μg/mL of nalidixic acid. Plasmids were isolated from the transconjugants by a Qiagen Mini Kit. The cjp5 DNA probe was used to screen for pVir as described above.

The Fisher exact test was used to test the significance (p<0.05) of the association between pVir and clinical symptoms, association of pVir and tetracycline-resistance plasmids, and the frequency of tetracycline resistance from this study and a previous study (22).

The patients were 7 months to 87 years of age (average 35 years); 47% were female. Ninety-five percent of the patients resided in Alberta, and the remaining 5% were from other Canadian provinces. Only 10 patients reported a history of travel outside Canada before becoming ill, namely to Mexico (3 patients), Alaska, Nicaragua, Ecuador, England, India, Lebanon, and Africa (1 patient each). The most commonly reported clinical symptom was diarrhea (99%); the exception was in an 86-year-old woman, who had an ileus. Other commonly reported symptoms were abdominal pain (83%) and fever (77%). Bloody stool was reported in 27% of patients and vomiting in 30% of patients; 18% of patients were hospitalized for treatment of severe dehydration. Fifty-eight patients received antimicrobial therapy: 34 ciprofloxacin (1 was switched to erythromycin after culture results, 2 received ciprofloxacin in combination with metronidazole), 20 macrolides (13 erythromycin, 5 clarithromycin, 3 azithromycin), 2 metronidazole (1 in combination with cephalexin), 1 amoxicillin, and 1 cotrimoxazole. Sixteen patients had other associated conditions: 4 cardiac disorders (2 arrhythmias, 2 ischemic heart disease), 3 hypertension (1 also had chronic obstructive pulmonary disease), 3 diabetes, 2 neoplasms (1 leukemia, 1 Wilm tumor), 2 gastrointestinal disorders (1 ulcerative colitis, 1 irritable bowel), 1 hepatitis C, and 1 seizure. Campylobacteremia with febrile seizures developed in a previously healthy patient.

The antimicrobial susceptibility of 104 human isolates of C. jejuni is shown in Table 1. Tetracycline resistance was identified in 63 isolates (60%); of these, 4 isolates were also resistant to nalidixic acid, 2 isolates were also resistant to kanamycin, and 1 isolate was also resistant to both nalidixic acid and kanamycin. Three of the 4 nalidixic acid–resistant isolates were also resistant to ciprofloxacin. In the tetracycline-sensitive isolates, no resistance to other antimicrobial agents was detected.

Tetracycline-resistance plasmids were found in 50 (79%) of 63 tetracycline-resistant isolates. DNA-DNA hybridizations for the cjp5 gene on pVir determined that 18 (17%) of 104 C. jejuni isolates contained the pVir plasmid. Stocked frozen clinical isolates had a slightly higher frequency of pVir than fresh clinical isolates (18% vs. 13%, respectively), most likely because of sampling error. Tetracycline-resistance plasmids were found in 17 (94%) of 18 pVir-positive C. jejuni isolates compared with 33 (38%) of 86 pVir-negative isolates. The presence of pVir plasmids was associated with the presence of tetracycline-resistance plasmids (p<0.00001). Alternatively, 33 (66%) of the 50 isolates that contained tetracycline-resistance plasmids did not contain pVir, demonstrating that plasmid-mediated tetracycline resistance does not occur exclusively with pVir.

Pain, diarrhea, vomiting, and fever were equally likely to occur in all C. jejuni infections, regardless of the presence of pVir (Table 2). However, 53% of patients infected with pVir-positive C. jejuni strains had bloody stool, as opposed to 21% of patients infected with pVir-negative C. jejuni strains (p = 0.011). pVir was not associated with age, sex, antimicrobial therapy, coexisting conditions, or travel. The patient with campylobacteremia and febrile seizures was infected with a pVir-negative C. jejuni. None of the patients infected with pVir-positive C. jejuni strains had a history of travel outside of Alberta in the week preceding the illness, and all of the patients who traveled outside of Alberta were infected with pVir-negative C. jejuni strains.

Tetracycline-resistant transconjugants contained ≈40-kb plasmids that carried tet(O) but were negative for pVir in DNA-DNA hybridizations with the cjp5 probe (data not shown). This finding confirmed the finding of Bacon et al. (15) that pVir could not be transferred with tetracycline-resistance plasmids in conjugal mating between C. jejuni strains.