The production and routine maintenance of the human-induced pluripotent stem cells (hu-iPSCs) used in this study have been described in detail previously (25). In brief, codon 129MV (ACS-1023; ATCC) and 129MM hu-iPSCs (RAH019A) (26) were routinely cultured on low growth factor Matrigel in mTeSR1 Plus medium with 5% CO₂ in a humidified incubator and passaged before colonies started to contact each other.

Knockout (KO) of PRNP by CRISPR/Cas9 cloning was performed by Applied StemCell (https://www.appliedstemcell.com). The guide RNAs G1 GCTTCGGGCGCTTCTTGCAG and G2 CTGGGGGCAGCCGATACCCG were used to introduce a frameshift mutation around aa 21 (within the N terminal signal sequence) (Appendix).

We generated cerebral organoids using the cerebral organoid differentiation kit (StemCell Technologies, https://www.stemcell.com), which follows the protocol described in Lancaster et al. (27). After differentiation, cultures were maintained in conical flasks on an orbital shaker at 80 rpm in complete maintenance medium: 1 × glutamax, 1 × penicillin/streptomycin solution, 0.5% vol/vol N2, 1% vol/vol B12 with retinoic acid (all ThermoFisher Scientific, https://www.thermofisher.com) and 0.5 × nonessential amino acids, 0.025% vol/vol insulin, and 0.00035% vol/vol 2-Merceptoethanol (all Sigma-Aldrich, https://www.sigmaaldrich.com) in 1:1 Neurobasal:DME-F12 medium (ThermoFisher Scientific), under standard incubator conditions (5% CO₂, 37°C, humidified).

We cultured hCOs for 5 months before infection to enable the development of astrocytes and maturation of neurons (28). We diluted previously characterized brain homogenates (29) from an uninfected deer, a pool of 6 CWD-infected mule deer, a pool of 7 CWD-infected white-tailed deer, an uninfected elk, a pool of 6 CWD-infected elk, and sporadic CJD (sCJD) (MV2) into organoid maintenance media to a final concentration of 0.1% (tissue wet) wt/vol (Table). Control sCJD brain homogenate was a kind gift from Gianluigi Zanusso (University of Verona, Italy). At the start of infection, existing media were removed from the organoids and replaced with the inoculated media. At 24 hours after inoculation, we added an equivalent volume of fresh media to the cultures (diluting the original inoculum 1:1). We performed a full media and vessel exchange 7 days after initial exposure.

We performed RT-QuIC assays as previously described (25). We homogenized organoids to 10% wt/vol in phosphate-buffered saline by motorized pestle and cleared by centrifugation at 2,000 × g for 2 minutes. We serially diluted organoid homogenates diluted in 0.1% sodium dodecyl sulfate/phosphate-buffered saline/N2 solution to 0.1% wt/vol, a 10⁻³ dilution, and loaded 1 μL into each well of a black 384-well plate with a clear bottom (Nunc) containing 49 μL of reaction mixture. RT-QuIC reaction mix contained 10 mM phosphate buffer (pH 7.4), 300 mM NaCl, 0.1 mg/ml of truncated hamster recombinant PrP (amino acids 90–231), 10 μM thioflavin T (ThT), 0.002% SDS (contributed by homogenate dilution), and 1 mM ethylenediaminetetraacetic acid tetrasodium salt (EDTA). We sealed plates using a Nalgene Nunc International sealer (ThermoFisher Scientific) and incubated in a FLUOstar Omega plate reader (BMG LabTech, https://www.bmglabtech.com) at 50°C with cycles of 60 seconds of shaking (700 rpm, double-orbital) and 60 seconds of rest throughout the 50-hour incubation time. We took ThT fluorescence measurements (excitation, 450 + 10 nm; emission, 480 + 10 nm [bottom read]) every 45 minutes. We ran quadruplicate reactions for each sample. We considered an individual reaction positive if its maximum fluorescence reading within 50 hours was >10% of the maximum fluorescence reading in the experiment. We considered a sample positive if >25% of the replicate reactions were scored as positive. We performed estimates of the concentrations of seeding activity using endpoint dilution analysis and calculated with Spearman-Kärber analyses as previously described (25) and provided as 50% seeding dose.

We submitted 2–6 organoids from each experimental group for histologic studies. Organoids were immersed in 3.7% neutral buffered formalin for ≈24 hours before standard embedding in paraffin. We performed immunohistochemical (IHC) staining specifically for PrP using 3 different PrP antibodies: SAF32 (Cayman Chemical, https://www.caymanchem.com) (30), F89/160.1.5 (F89) (GeneTex, https://www.genetex.com) (31) and F99/97.6.1 (F99) (VMRD, Inc., https://vmrd.com) (31). We sectioned organoids into 5-µm slices and performed deparaffinization, antigen retrieval and staining using the Discovery Ultra Staining Module (Roche, https://www.roche.com). We retrieved antigens for all PrP IHC staining by using extended cell conditioning with CC1 buffer (Roche) containing Tris-Borate-EDTA, pH 8.0 for 100 minutes at 95°C. Before staining, we applied a horse serum blocker (Vector #136021) at 37°C for 20 minutes. To stain PrP, we applied either SAF32 at a dilution of 1:2,000, F89 at 1:250, or F99 at 1:25 for 1 hour at 37°C. We performed all antibody dilutions using antibody dilution buffer (Roche). The secondary antibody for all 3 primary PrP antibodies was horse anti-mouse IgG (Vector #30129), applied undiluted for 32 minutes at 37°C, followed by detection with ChromoMap DAB (Roche). We digitized and analyzed all histopathology slides using Aperio Imagescope software (https://www.leicabiosystems.com/us/digital-pathology/manage/aperio-imagescope).

We performed proteinase K digests and Western blot analysis as described previously (25). In brief, we treated 10% organoid homogenates with 5 μg/mL proteinase K in 1% Sarkosyl for 1 hour at 37°C with 400 rpm shaking. We ran equal volumes of the digested 10% homogenates on Bolt 4%–12% Bis-Tris gels and transferred to PVDF membranes using the iBlot 2 transfer system (ThermoFisher Scientific). We detected PrP by using the 3F4 antibody (Millipore Sigma, https://www.emdmillipore.com) at a 1:10,000 dilution, visualized using ECL Select (Cytiva, https://www.cytivalifesciences.com), and imaged on the iBright imaging system (ThermoFisher Scientific). We visualized total protein with Coomassie blue staining.

We assessed relative organoid health using PrestoBlue metabolism and lactate dehydrogenase (LDH) release assays, per the manufacturer’s instructions. In brief, we plated 3–6 random representative organoids from each group in 24-well plates with 0.5 mL of fresh media. Approximately 24 hours later, we mixed 50 µL media with 50 µL LDH catalyst and dye in a 96-well plate, then incubated the plate for 15 minutes at 37°C before adding 25 µL of stop solution. We measured absorbance on the ClarioStar plate reader (BMG LabTech) at 460 nm, subtracting reference wavelength 690 nm from the reading. Once LDH was measured, we used the same organoids for PrestoBlue metabolism. We diluted PrestoBlue reagent in organoid maintenance media at a 1:10 ratio. We then removed the organoids’ existing media, added 0.5 mL of the PrestoBlue media, and incubated at 37°C for 30 minutes before transferring the media to a black 96-well plate for analysis. We measured fluorescence at 560 nm excitation and 590 nm emission in the ClarioStar plate reader. Values are presented as relative change from the normal brain homogenate (NBH) controls.

We immersed hCOs for 7 days in media containing negative control normal brain inocula either from humans (hNBH), deer (dNBH), or elk (eNBH) or infectious prions from sCJD human brain homogenate (CJD; positive control), 2 species of deer (dCWD1, dCWD2), or elk (eCWD), as previously described (Table). We monitored hCOs for 180 days after infection for visible signs of distress, including changes in appearance and metabolizing of the media. Before the final harvest, we assessed 3 or 4 organoids from each treatment group for differences in metabolism by PrestoBlue viability assay or cellular integrity by LDH release. Although there was wide variability in the organoid responses, no signs of decreased health were evident in any condition (Figure 1). Thus, exposure to the homogenates had no influence on organoid viability.

We have previously demonstrated that 129MV hCOs are susceptible to infection with human 129MV prions (25,32) and that 129MM hCOs are susceptible to infection with human 129MM prions (33). As a positive control, and to ensure that 129MM organoids were also susceptible to 129MV prions, we inoculated both organoid lines (129MV and 129MM) with 129MV2 human sCJD prions and assessed RT-QuIC seeding activity and protease-resistant PrP (a biochemical marker of disease associated prion deposition) at 56 and 180 days postinoculation (dpi). RT-QuIC seeding activity was present at 56 dpi and showed a significant increase after incubation to 180 dpi (Figure 2, panel A). No protease-resistant PrP could be detected within the organoids at 56 dpi, but significant accumulation had occurred by 180 dpi (Figure 2, panel B). Therefore, the CJD control organoids did take up infection and propagate it, with accumulation over time.

RT-QuIC analysis of the organoids collected at 180 dpi showed that, with the exception of the CJD-positive controls, no inoculum in either the codon 129MM or 129MV organoids resulted in the production of significant seeding activity (Figure 3). In the case of the 129MM hCOs, some weak positive signals were observed (Figure 3; Appendix Figure 2). However, similar observations were made in genetically matched PrP KO organoids (Figure 3; Appendix Figure 2, gray markers), which have no PrP substrate for propagation of misfolding. Coupled with a decline in seeding activity over the course of the experiment (Appendix Figure 2), this finding suggests that the observed signals are a likely result of residual inocula persisting in the organoids for a prolonged period, producing false-positive reactions. Altogether, RT-QuIC analysis for prion seeding activity indicated that none of the CWD-inoculated organoids contained seeding activity indicative of actively propagating infection, such as is seen with CJD-infected hCOs.

Accumulation of disease-associated, protease-resistant PrP is also a hallmark of prion disease. Therefore, we probed organoid homogenates from the CWD infections for PrP levels with and without proteinase K digestion. Protease-resistant PrP was only observed in the CJD-infected control organoids and not in any of the CWD-exposed organoids (Figure 4), and none of the CWD conditions showed a significant increase in total PrP levels (Figure 4).

Histologic examination of the tissues at the conclusion of the experiment (180 dpi) showed no evidence of pathology or plaques within the CWD-inoculated organoids. However, several dCWD2 and eCWD organoids contained scattered regions of abnormal PrP deposition. Although the PrP KO organoids showed no native PrP staining compared with the background hue of normal PrP expression seen in the wild type organoids, further examination revealed abnormal PrP deposits similar to those seen in the wild type organoids using the SAF32 PrP antibody. This finding indicates that the deposits are likely residual CWD inoculum and not de novo deposition of human PrP (Figure 5, panel A). To verify that those deposits were indeed residual inocula, we further analyzed the tissue slices using F89 and F99 PrP antibodies. F89 is a PrP antibody that detects both cervid and human PrP, similar to SAF32, whereas F99 is a PrP antibody that detects only cervid PrP and not human PrP. Staining with F89 demonstrated similar results for both CJD- and CWD-exposed organoids, similar to that of SAF32. However, when stained with the F99 cervid PrP antibody, only the CWD-exposed hCOs showed PrP staining, confirming that the positive staining material was cervid in origin and not converted human PrP (Figure 5, panel B; Appendix Figure 4). Altogether, despite clear accumulation of pathogenic (seeding positive, protease-resistant) PrP in the sCJD-infected organoids, prolonged, high-dose exposure of hCOs to CWD prions was not sufficient to cause conversion of human PrP or disease propagation.