Materials and Methods

pmc

0375400

4942

J Med Entomol

Journal of medical entomology

0022-25851938-2928

33511396

10947375

10.1093/jme/tjaa291

HHSPA1964626

Article

Surveillance of Ticks and Tick-Borne Pathogens in Suburban Natural Habitats of Central Maryland

Milholland

Matthew T.

12Eisen

Lars

http://orcid.org/0000-0002-1925-2166

Nadolny

Robyn M.

4Hojgaard

Andrias

http://orcid.org/0000-0002-6492-0901

Machtinger

Erika T.

http://orcid.org/0000-0003-4695-059X

Mullinax

Jennifer M.

http://orcid.org/0000-0002-8346-5780

Andrew Y.

1Invasive Insect Biocontrol and Behavior Laboratory, USDA, ARS, Bldg. 007, Rm. 301, BARC-West, 10300 Baltimore Avenue, Beltsville, MD 207052AGNR-Environmental Science and Technology, University of Maryland, College Park, MD3Division of Vector-Borne Diseases, Centers for Disease Control and Prevention, Fort Collins, CO4Tick-Borne Disease Laboratory, Army Public Health Center, Aberdeen Proving Ground, MD5Department of Entomology, Pennsylvania State University, University Park, PA

6Corresponding author, Andrew.Li@usda.gov

2722024

1552021

1832024

58313521362

Lyme and other tick-borne diseases are increasing in the eastern United States and there is a lack of research on integrated strategies to control tick vectors. Here we present results of a study on tick-borne pathogens detected from tick vectors and rodent reservoirs from an ongoing 5-yr tick suppression study in the Lyme disease-endemic state of Maryland, where human-biting tick species, including Ixodes scapularis Say (Acari: Ixodidae) (the primary vector of Lyme disease spirochetes), are abundant. During the 2017 tick season, we collected 207 questing ticks and 602 ticks recovered from 327 mice (Peromyscus spp. (Rodentia: Cricetidae)), together with blood and ear tissue from the mice, at seven suburban parks in Howard County. Ticks were selectively tested for the presence of the causative agents of Lyme disease (Borrelia burgdorferi sensu lato [s.l.]), anaplasmosis (Anaplasma phagocytophilum), babesiosis (Babesia microti), ehrlichiosis (Ehrlichia ewingii, Ehrlichia chaffeensis, and ‘Panola Mountain’ Ehrlichia) and spotted fever group rickettsiosis (Rickettsia spp.). Peromyscus ear tissue and blood samples were tested for Bo. burgdorferi sensu stricto (s.s), A. phagocytophilum, Ba. microti, and Borrelia miyamotoi. We found 13.6% (15/110) of questing I. scapularis nymphs to be Bo. burgdorferi s.l. positive and 1.8% (2/110) were A. phagocytophilum positive among all sites. Borrelia burgdorferi s.s. was found in 71.1% (54/76) of I. scapularis nymphs removed from mice and 58.8% (194/330) of captured mice. Results from study on tick abundance and pathogen infection status in questing ticks, rodent reservoirs, and ticks feeding on Peromyscus spp. will aid efficacy evaluation of the integrated tick management measures being implemented.

Lyme diseaseblacklegged ticktick-borne pathogenBorreliaPeromyscus

Tick-borne diseases are increasing in the United States, and Lyme disease accounts for the majority of reported cases (Rosenberg et al. 2018). In Maryland, where the present research was carried out, Lyme disease was first reported in 1979 and became a state reportable zoonosis in 1989 (Strickland et al. 1994, Glass et al. 1995). Currently, Maryland ranks in the top 10 states in terms of annual reported Lyme disease cases (CDC 2020). In the Mid-Atlantic region, including Maryland, and the Northeast, Lyme disease is caused by Borrelia burgdorferi sensu stricto (s.s.) (Spirochaetales: Spirochaetaceae), a spirochete maintained in an enzootic cycle involving the blacklegged tick, Ixodes scapularis Say (Acari: Ixodidae), and several vertebrate reservoir species including the white-footed mouse, Peromyscus leucopus (Rafinesque) (Rodentia: Cricetidae), which is an important host for the immature tick life stages (LoGiudice et al. 2003). The white-tailed deer, Odocoileus virginianus (Zimmermann) Artiodactyla: Cervidae, does not serve as a reservoir for B. burgdorferi s.s. but is an important reproductive host for I. scapularis adults, driving tick population increases that lead to intensified enzootic spirochete transmission and increased risk of human bites by infected ticks (Telford et al. 1988, Amerasinghe et al. 1993, Halsey et al. 2018, Telford 2018).

Other factors influencing enzootic pathogen transmission and acarological risk for human bites by infected ticks include genetic variability of B. burgdorferi s.s., variable host species assemblages, landscape features, and climate conditions (Glass et al. 1995, Alghaferi et al. 2005, Anderson and Norris 2006, Jackson et al. 2006, Brisson et al. 2008, Simon et al. 2014, Kilpatrick et al. 2017). As a human vaccine for Lyme disease is still lacking and use of other personal protection measures has not proven adequate to prevent the increase of Lyme and other tick-borne diseases, there is a continued need to develop and evaluate environmentally based strategies to suppress populations of human-biting ticks and reduce the intensity of enzootic pathogen transmission (Carroll et al. 2009; Stafford et al. 2017; Williams et al. 2018a, b; Eisen and Stafford 2020). Surveillance of tick-borne pathogens can help shape management strategies aimed at reducing the density of infected ticks, particularly the nymphal stage, which can go undetected when biting humans (Stafford et al. 2017).

Transmission potentials are thought to be higher in edge habitat when compared to deeper forest (Williams et al. 2018a, b), though much of that risk has been attributed to increased human activity associated with forest edges rather than true acarological risk (Horobik et al. 2006). Moreover, some tick-borne pathogens, like Anaplasma phagocytophilum, Babesia microti, B. burgdorferi sensu lato (s.l.) and Borrelia miyamotoi, have been shown to co-occur frequently (Diuk-Wasser et al. 2016) and can demonstrate mutualistic associations when found as coinfections in I. scapularis (Swanson et al. 2006) or Peromyscus mice (Dunn et al. 2014, Kilpatrick et al. 2017). Larval and nymphal I. scapularis may acquire coinfections when feeding on rodents and the resulting molted nymphs and adults could transmit the co-infecting pathogens during the subsequent bloodmeal (Walter et al. 2016).

In the current study, we present baseline data on density of host-seeking ticks and pathogen infection in ticks and rodent reservoirs prior to the implementation of a 5-yr integrated pest management (IPM) project conducted in urban parks in central Maryland and including different combinations of three control technologies: topical application of acaricides to deer, topical application of acaricides to rodents, and broadcast application of entomopathogenic fungus. In addition to I. scapularis and its associated human pathogens (including Bo. burgdorferi s.l., Bo. miyamotoi, A. phagocytophilum, and Ba. microti), the study areas harbor two other species of humanbiting ticks—Amblyomma americanum (L.) and Dermacentor variabilis (Say) (Acari: Ixodidae)—that serve as vectors for Ehrlichia spp. and Rickettsia spp. pathogens.

Materials and MethodsStudy Sites

Seven suburban parks within Howard County, Maryland were included in the study: Blandair (BL; 39°13′17.18″N, 76°49′44.50″W), Cedar Lane (CL; 39°13′52.34″N, 76°53′5.18″W), Centennial (CT; 39°14′47.65″N, 76°51′29.06″W), David Force (DF; 39°17′25.08″N, 76°52′28.25″W), Middle Patuxent Environmental Area (MPEA; 39°12′57.50″N, 76°55′2.52″W), Rockburn (RB; 39°13′8.70″N, 76°46′25.96″W), and Wincopin Trails (hereafter, Wincopin; 39°8′55.98″N, 76°50′9.73″W). Because single-family homes were adjacent to each drag transect and trapping grid, we define our parks as peridomestic forests.

Tick Sampling

The relative density of host-seeking adult and nymphal ticks of different species was determined in each park by drag-sampling along two concurrent parallel transects (Blandair = 680 m; Cedar Lane = 400 m; Centennial = 600 m; David Force = 475 m; MPEA = 450 m, RB = 500 m; and Wincopin = 630 m). The parallel transects were located within 50 m of forest edge under the assumption this forest depth had a high likelihood of potential host use (Simon et al. 2014) and would be representative of the tick assemblage composition at and near the forest edge (Gallo et al. 2017). Cloths of 1 m² white corduroy were dragged along vegetation following the two transects at a slow pace and checked for ticks every 10 m. Collected ticks were placed into microcentrifuge tubes with ≥70% ethanol. Sites were drag-sampled for ticks twice per month from May to November 2017. Additionally, ticks were removed from captured rodents (described below) and stored in ≥70% ethanol. Ticks were identified to species and life stage following taxonomic keys (Cooley 1946, Keirans and Clifford 1978, Keirans and Litwak 1989) and subjected to pathogen detection as described below.

PCR Assays for Pathogen Detection in Ticks

Nucleic acids were isolated from ticks using the Qiagen DNeasy Blood and Tissue Kit and the Tissues and Rodent Tails protocol on the QIAcube instrument (Qiagen, Valencia, CA). For questing ticks, all I. scapularis specimens were processed individually because of high expected pathogen prevalence. Questing A. americanum and D. variabilis ticks were pooled in groups of five, so that aliquots of five individual tick homogenates were combined, isolated, and tested together. Individual samples were archived at −20°C to be used later if the pool tested positive for a pathogen. For ticks removed from mice, all ticks of the same species and life stage removed from a single mouse were combined in one tube for isolation.

Ticks were tested for human pathogens for which their species are known to serve as vectors. Therefore, I. scapularis were tested for presence of A. phagocytophilum, Ba. microti, and Bo. burgdorferi s.l.; A. americanum were tested for Ehrlichia ewingii, Ehrlichia chaffeensis, and “Panola Mountain” Ehrlichia; and D. variabilis were screened for bacteria in the genus Rickettsia. Nucleic acid of Rickettsia rickettsii, kindly provided by Abdu Azad (University of Maryland School of Medicine), was used as positive control for all reactions above. Detailed method has been reported previously by Stromdahl et al. (2011). Positive controls were used in all PCR reactions. All initial positive results were confirmed by testing the DNA extract with a second PCR for a different genetic region if available, and positive specimens were defined as samples that produced at least two separate PCR positive results. PCR cycling conditions are as described in the original articles mentioned below.

Ixodes scapularis-associated pathogens were detected as follows. Real time PCR to detect Bo. burgdorferi s.l. was performed using primers and a probe designed to anneal to the OspA gene of Bo. burgdorferi s.l. (Straubinger 2000). Any samples positive in this assay were tested again in a real-time PCR targeting the inner part of the fla gene of Bo. burgdorferi s.l. (Leutenegger et al. 1999). For Ba. microti, the PCR was performed using a real-time assay targeting the 18S rRNA gene of Ba. microti (Tonnetti et al. 2009) or a real-time assay targeting a different section of the 18S rRNA gene of Ba. microti (Rollend et al. 2013). For A. phagocytophilum, the primary PCR screen was performed using a melting curve analysis of amplification of the groESL gene which differentiates A. phagocytophilum from Ehrlichia spp. as described previously (Bell and Patel 2005). Any samples that were positive for A. phagocytophilum were confirmed using a nested PCR targeting the 16S r RNA gene of A. phagocytophilum (Massung et al. 1998).

Amblyomma americanum-associated pathogens were detected as follows. PCR was performed using a melting curve analysis of amplification of the groESL gene which differentiates A. phagocytophilum, E. chaffeensis, E. ewingii, Ehrlichia muris eauclairensis, and ‘Panola Mountain’ Ehrlichia (Bell and Patel 2005, Stromdahl et al. 2012, Stromdahl et al. 2014). Any samples positive for E. chaffeensis were reconfirmed by a PCR using primers for the 16S rRNA gene of E. chaffeensis (Loftis et al. 2003). Any samples positive for E. ewingii were reconfirmed by PCR using primers for the p28 gene of E. ewingii (Gusa et al. 2001). Any samples positive for Ehrlichia sp. ‘Panola Mountain’ were reconfirmed by a separate PCR using primers for the gltA gene of Ehrlichia sp. ‘Panola Mountain’ (Loftis et al. 2008).

Dermacentor-associated pathogens were detected as follows. PCR was performed for Rickettsia spp. using primers for the ompB gene (Jiang et al. 2012) and confirmed and speciated using amplification of the ompA gene (Rr190.70p and Rr190.602n) followed by a Pst1 restriction fragment RFLP (Regnery et al. 1991).

Rodent Capture and Sampling

All rodent sampling occurred with United States Department of Agriculture (USDA) authorization under permit 15–030, IACUC16–023. Rodents were captured with Sherman live traps (LFAHD folding trap, H. B. Sherman Traps, Inc., Tallahassee, FL). Each site was sampled twice per month from 25 May through 24 November 2017. Traps were placed in two, 36-trap grids per park and operated for two consecutive nights. The two 6 × 6 grids at each site were placed spatially independent to act as subsets per site. Grid transects began 10 m into the forest from the property-lines on the forest edge with rows continuing deeper into forest habitat at ~10 m intervals. Traps were stationed in preferred rodent microhabitat (Drickamer 1990) within a 5 m radius of grid points.

Peromyscus leucopus and P. maniculatus (Wagner) (Rodentia: Cricetidae) co-occur in Maryland (Hall 1981). Molecular methods, such as PCR, are a more reliable method used to differentiate the two Permomyscus species compared to using phenotypic traits alone, particularly when identifying juveniles (Fiset et al. 2015, Long et al. 2019). Due to logistical constraints, sequencing of rodent genotypes from samples did not occur. Thus, to avoid erroneous conclusions on tick ecology, we refer to trapped rodents as Peromyscus spp. (Machtinger and Williams 2020). Captured rodents were temporarily sedated with isoflurane and examined for presence of ticks. Recovered ticks were placed in ≥80% ethanol. Blood (approximately 100 μl) was collected via subocular puncture on Whatman #4 filter paper (GE Healthcare, Chicago, IL) and allowed to dry before cold storage. An ear biopsy was performed using an ear punch (Integra Miltex, York, PA) and ear samples were placed in RNA Later (Qiagen) and stored at 4°C until processing. Each rodent also was given a unique ear tag identifier (Stoelting Inc., Wood Dale, IL). Marked rodents were then released at the location of their capture.

Rodent Infection With Tick-Borne Pathogens

Nucleic acid was isolated from rodent blood samples as previously described (Fedele et al. 2020). Briefly, 400 μl of lysis buffer (376 μl ATL; 20 μl proteinase K; 2 μl Reagent DX; and 2 μl Carrier RNA, 1 μg/μl; Qiagen) was added to each tube containing the blood sample and samples were incubated for 20 min at 56°C. Nucleic acid was isolated from rodent ear tissue samples as follows. First, the ear tissue sample was placed in a tube containing 100 ml PBS/collagenase A (100 mg collagenase A/ml; Roche, Indianapolis, IN) and incubated for 4 h at 37°C. Second, 300 μl of lysis buffer (276 μl ATL; 20 μl proteinase K; 2 μl Reagent DX; and 2 μl Carrier RNA, 1 μg/μl) was added to each tube containing the ear tissue sample and the sample was incubated overnight at 56°C. Following the final incubation step for each of the sample types, 300 μl lysate of either the blood sample or the ear tissue sample was processed using the KingFisher DNA extraction system and the MagMAX Pathogen RNA/DNA Kit (ThermoFisher Scientific, Houston, TX).

For blood samples, the subsequent multiplex TaqMan PCR reactions included previously described (Fedele et al. 2020) in-house primer and probe master mixes (M73 and M74) targeting A. phagocytophilum (msp2 and msp4 genes), Ba. microti (sa1 gene and 18S rDNA), Bo. miyamotoi (purB and glpQ genes), and rodent GAPDH (Applied Biosystems TaqMan Rodent GAPDH ControlReagents kit; Thermo Fisher Scientific). For ear tissue samples, we used two different in-house primer and probe master mixes (M76 and M78; Table 1) targeting Bo. burgdorferi s.l. (chromosomal DNA), Bo. burgdorferi s.s. (oppA2 gene), Borrelia mayonii (oppA2 gene), Bo. miyamotoi (purB and glpQ genes), and rodent GAPDH. The rodent GAPDH target was included as a PCR and DNA purification control. PCR reactions for M73, M74 and M78 were performed in 15 μl solutions with 7.5 μl iQ Multiplex Powermix (Bio-Rad, Hercules, CA), 5 μl DNA extract, primers/probes, and water. PCR for M76 was performed in 25 μl with 12.5 μl iQ Multiplex Powermix, 5 μl DNA extract, primers/probes, and water.

The TaqMan PCR cycling conditions for M73 consisted of: denature DNA at 95°C for 3 min followed by 40 cycles of 95°C for 10 s and 60°C for 30 s on a C1000 Touch thermal cycler with a CFX96 real-time system (Bio-Rad). The TaqMan PCR cycling conditions for M74 and M78 consisted of: denature DNA at 95°C for 3 min followed by 40 cycles of 95°C for 10 s and 65°C for 30 s. The TaqMan PCR cycling conditions for M76 consisted of: denature DNA at 95°C for 3 min followed by 40 cycles of 95°C for 10 s and 58°C for 60 s. All PCR samples were analyzed using CFX Manager 3.1 software (Bio-Rad) with the quantitation cycle (Cq) determination mode set to regression. Based on Graham et al. (2016), only Cq values <40 were considered indicative of a pathogen target being present in the tested sample.

Tick Density

Tick density was calculated as the number of ticks collected by drag-sampling divided by twice the transect distance (m). Doubling the transect length accounts for two collectors dragging for ticks side-by-side. Due to site variation in transect length, all tick densities were standardized to 100 m². Tukey’s honestly significant difference (HSD) multiple comparisons of means was used to make parameter comparisons across temporal and geographic scales. Spatially explicit factors were mapped with ArcMap 10.6.1. (Esri, Redlands, CA) using the North American Datum of 1983 (NAD 1983) latitude/longitude projection.

Generalized Linear Mixed-Effects Model

A generalized linear mixed-effects model (glmm) was produced using the glmmML package (Broström 2020) to estimate the likelihood of abiotic and biotic factors contributing to Bo. burgdorferi s.l. infection in Peromyscus-fed I. scapularis. We modeled Peromyscus-fed I. scapularis infection status (binary as infected with Bo. Burgdorferi s.l. or not infected) as a function of trap depth into forest (spatial gradient) and at different times of the year (seasonal gradient) to estimate the likelihood of encountering rodents with Bo. burgdorferi s.l.-infected ticks. Three seasonal categories were assigned to capture data occurring within the spring (4 May to 20 June 2017), summer (21 June to 20 September 2017), and fall (21 September to 15 November 2017). Simulating edge use, the spatial categories were used to determine the likelihood of encountering Bo. burgdorferi s.l.-infected I. scapularis larvae or nymphs on rodents relative to forest edge or if infection probabilities were related to the season of capture. Three gradient categories indicated forest depth from the peridomestic edge-forest interface. Site was treated as a random effect with fixed effects, including time of year (season), distance from edge, and tick life stage (larva or nymph). Infection status of I. scapularis removed from rodents was used as the binary response. Statistical analyses were done using R (R version 4.0.1 ‘See Things Now’, The R Foundation for Statistical Computing, www.R-project.org). Infection frequency (prevalence) was calculated as the proportion of infected individuals within a constrained sample size. We also used the ‘prevalence’ package (Devleesschauwer et al. 2015) and Jeffreys Priors to calculate the 95% Bayesian Credible intervals (CI) for prevalence estimations from infection frequencies (Modarelli et al. 2020).

ResultsQuesting Ticks

As shown in Table 2, the total of 207 ticks collected from drag-sampling included 65 A. americanum (55 nymphs and 10 adults), 3 Dermacentor albipictus (Packard) adults, 1 D. variabilis adult, and 138 I. scapularis (110 nymphs and 28 adults; May-November). Ixodes scapularis nymphs were most active in the early summer (May-July) with 15/110 (13.6%) of collected nymphs positive for B. burgdorferi s.l. The Rockburn site yielded the highest number of I. scapularis (n = 41) with 7 (17%) Bo. burgdorferi s.l. infections and Blandair the lowest (n = 8 ticks) and no Bo. burgdorferi s.l. infections. Amblyomma americanum was the dominant tick species (n = 44) at Wincopin and this site accounted for the only two E. chaffeensis (2%) infections. However, no A. americanum were collected from Centennial or David Force and no questing ticks were found to carry coinfections.

Host-seeking activity of A. americanum and I. scapularis nymphs was highest from May to July and peaked in June (Fig. 1). Ixodes scapularis nymphs were detected throughout the study period (May–November). The mean number of I. scapularis nymphs collected from May to July was 0.8 (SE ± 0.4) at Blandair, 1.3 (SE ± 0.6) at Cedar Lane, 2.2 (SE ± 1.1) at Centennial, 1.7 (SE ± 0.4) at David Force, 3.0 (SE ± 1.3) at MPEA, 5.6 (SE ± 2.3) at Rockburn, and 2.5 (SE ± 1.0) at Wincopin. Nymphal tick activity, determined by drag-sampling success, was reduced between August-November compared to May–July (Fig. 1). Because sample sizes were low, sites were grouped for a more robust estimate of prevalence. We found 14% (15/110; CI = 8.5–21.4%) of I. scapularis nymphs to be Bo. burgdorferi s.l. positive among sites. Prevalence of A. phagocytophilum was lower, with 1.8% (2/110; CI = 0.6–6.2%) of I. scapularis nymphs infected.

Adult Dermacentor spp. were collected from August to October at four sites, including Blandair (n = 1, male D. albipictus), Cedar Lane (n = 1, male D. variabilis), Centennial (n = 1, female D. albipictus), and David Force (n = 1, male D. albipictus) (Table 2). Neither species were collected from the environment at MPEA, Rockburn, or Wincopin.

Ticks Removed From Rodents

A total of 601 rodents, including 330 uniquely identifiable individuals, were captured over 5,040 trap nights with a trap success of 12% (601/5,040), yielding a total of 602 ticks representing two species (588 I. scapularis, larvae = 516, nymphs = 72; 19 D. variabilis, larvae = 15, nymphs = 4) that were removed from rodents from May to September (Fig. 2; Table 5). Average tick burden on Peromyscus was found to be 3 (SE ± 0.5) I. scapularis larvae or nymphs per rodent, ranging from two ticks/rodent host at Blandair to five ticks/rodent at Cedar Lane. Ixodes scapularis nymphs were detected on rodents at all sites from May to September, although in greatest numbers at David Force (n = 39). Few (n = 9) larvae were removed prior to July sampling. Overall, larval-burdens on Peromyscus were greatest from July to September and nymphal-burdens highest in May and June (Fig. 2). We also found D. variabilis infesting Peromyscus in the months of May and June, though not as frequently as I. scapularis overall (Fig. 2).

Prevalence of Bo. burgdorferi s.l. infection in I. scapularis from rodents was overall very high (mean = 64%; SE ± 12), although site variation was wide-ranging from 0 to 100% (Table 3). Anaplasma phagocytophilum was found to occur in 2/15 (13%) nymphs from rodents at Blandair and in 4/39 (10%) of nymphs at David Force. Anaplasma phagocytophilum occurred as a coinfection with Bo. burgdorferi s.l. in 100% (4/4) of nymphs removed from Peromyscus at David Force, and 50% (1/2) at Blandair. The number of Bo. burgdorferi s.l.-infected nymphs feeding on Peromyscus differed significantly (T = 3.9; df = 109; P < 0.001) from Bo. burgdorferi s.l.-infected larvae (13.0%; 64/492; CI = 10–16%) removed from captured rodents. Although D. variabilis (n = 14) were removed from rodents, none were found to carry Rickettsia spp.

We found no differences in the number of ticks found on Peromyscus spp. hosts across edge gradients (F = 1.05; df = 2, 213; P = 0.35). The relative abundance of infected I. scapularis larvae and nymphs was highest in the spring and summer months though there were differences in Bo. burgdorferi s.l. prevalence across seasons (F = 4.68, df = 2, 18; P = 0.02), particularly between summer and fall (Tukey HSD = 34.3, CI = 3–66; P = 0.03). Results of our glmm analysis suggest a greater likelihood of nymphs (P < 0.01) carrying a tick-borne pathogen when compared to larvae. Also, our model suggests the greater the burdens of I. scapularis nymphs on individual Peromyscus hosts the more likely they are to harbor Bo. Burgdorferi s.l. (P = 0.02) compared to random chance alone (Table 4). Similar capture frequencies of infected Peromyscus occurred across edge gradients (F = 0.075; df = 2, 18; P = 0.92) suggesting spatial heterogeneity measured by mark and recapture sampling (Fig. 3).

Rodent Pathogen Infection and Coinfection

Pathogen-infected rodents were found at each site (Table 5). Borrelia burgdorferi s.s. was the most frequently detected pathogen with over half of the rodents (53%; SE ± 6) infected across all parks (Table 4). Infection prevalence of Bo. burgdorferi s.s. ranged between sites from 61/78 (78%; 68–86%) of rodents infected at DF to 11/31 (35.5%; CI = 21–53%) at MPEA. Babesia microti was detected at MPEA in 1/31(3.2%; CI = 0.7–4%) of the rodents suggesting a site prevalence of 3%. Anaplasma phagocytophilum was detected in rodents from 3 out of 7 study sites, including Blandair (3/88; 3.4%; CI = 28–48), MPEA (2/31; 6.5%; CI = 2–21), and David Force (33/78; 42.3%; CI = 32–53). However, none of A. phagocytophilum infection in mice existed as single pathogen infection. Coinfections of A. phagocytophilum and Bo. burgdorferi s.s. in rodents accounted for the largest proportion 37/38 (97%; CI = 87–99%) across sites. Moreover, Bo. miyamotoi was found in 3.4% of rodents (3/88; CI = 1–10%) at Blandair, 9.3% (4/43; CI = 4–22%) at Cedar Lane, 2.4% (1/42; CI = 1–12) at Centennial, and 2.6% (2/78; CI = 1–9%) at David Force (Table 4). Seasonal distributions of Bo. Burgdorferi s.s. prevalence in Peromyscus spp. showed a significant difference in infection when comparing the spring and summer to fall (F = 6.2; df = 2, 21; P = 0.007). Across all parks, landscape-level infection prevalence was highest in the spring (49%; SE ± 7.7) and summer (52%; SE ± 4.0), while lowest in the fall (18%; SE ± 9.7).

Discussion

High incidence of Lyme disease is typically associated with high densities of I. scapularis nymphs (Eisen and Eisen 2018). Densities of questing I. scapularis nymphs have also been shown to be greater in northern states compared to states toward southern latitudes (Diuk-Wasser et al. 2010) where nymphal questing behavior has been shown to differ (Arsnoe et al. 2019). Interestingly, Maryland ranks 7th in states with the highest incidence of Lyme disease in the United States (CDC 2020), although Maryland has relatively low nymph densities compared to other areas in the northeastern United States (Diuk-Wasser et al. 2010). Maryland is also geographically located in the mid-Atlantic region along the latitudinal gradient where I. scapularis questing behavior could be varied (Arsnoe et al. 2015) making the assessment of Lyme disease risk from questing I. scapularis nymphs alone challenging (Eisen and Eisen 2018).

Previous studies in Maryland have reported higher densities of I. scapularis nymphs, although the historical prevalence of Bo. burgdorferi s.l. has remained relatively similar. Swanson and Norris (2007) reported a mean density of 0.4 I. scapularis nymphs per 100 m² (SE ± 0.3) with 14.7% (51/348) found to be positive for Bo. burgdorferi s.s. in 2003. Approximately a decade later, Johnson et al. (2017) drag-sampled 3 Maryland parks in 2014–2015 and found host-seeking I. scapularis nymphs in still higher densities (mean density per 100 m² = 3.6, SE ± 1.8), though site prevalence of Bo. burgdorferi s.s. infection (10–36%) was similar to our Bo. burgdorferi s.l. infection of 21% (23/110; CI = 15–30%). However, when we consider Peromyscus individuals positive for Bo. burgdorferi s.s., our mean site prevalence (53%; SE ± 6%) was much higher than in the 2014–2015 study. This suggests Bo. Burgdorferi s.s. can persist in Peromyscus hosts in areas with lower nymph densities (Arsnoe et al. 2019).

Infection-risk can be estimated from monitoring the densities of host-seeking I. scapularis nymphs. Although our sites show a high prevalence (53%; SE± 6%) of Bo. burgdorferi s.s. circulating in Peromyscus hosts, other pathogens, including A. phagocytophilum, Ba. microti, and Bo. miyamotoi, were also present at sites where rodent relative densities were high. We found on the landscape level, I. scapualris nymphs collected from Peromyscus spp. with the highest burden were more likely to carry infected nymphs. This would suggest a higher probability of encountering infected nymphs in areas of high Peromyscus presence. Although questing nymph densities are low at our sites compared to Hofmeister et al. (1999) or Swanson and Norris (2007) rodent tick burdens seem to be at levels where pathogens are maintained in rodent hosts and parasitizing ticks.

Rodent tissue sampling can provide further insight into infection probabilities and the persistence of tick-borne infections in rodent hosts. Monitoring these levels of infection over time can be helpful in monitoring changes in tick-borne pathogen prevalence for a given geographic space. For example, Hofmeister et al. (1999) sampled P. leucopus rodents (n = 202) from 1991 to 1993 and found that 26% of rodents were infected with Borrelia across 3 yr and 42% were Borrelia-positive concurrent cross-sectional studies in Baltimore County, Maryland. A second study in 2001 determined 25% of 173 P. leucopus in the Maryland coastal plains to be infected with the ospA or ospC Borrelia burgdorferi variants (Anderson and Norris 2006). Though the previous study (Anderson and Norris 2006) focused on specific surface proteins for detection in rodent tissues, our study showed a higher Bo. burgdorferi s.s. mean prevalence (64%; Table 2) in rodents from 2017. Further, Zawada and others (2020) recently published tissue-specific detections of Borrelia infection in rodents from Fairfax, Virginia and report that 43% of rodent ear tissues were positive for Bo. burgdorferi s.l. (Zawada et al. 2020). We found 50.7% (194/382; CI = 46–56%) of overall Howard County Peromyscus at our study sites were infected with Bo. burgdorferi s.s.

Considering coinfections with other pathogens, we found 15/110 (13.6%; CI = 8.5–21.4%) of host-seeking nymphs to be infected with Bo. burgdorferi s.l. and overall the nymphs had an A. phagocytophilum prevalence of 2/110 (1.8%; CI = 0.6–6.2%), which is much higher than an earlier report of 0.3% A. phagocytophilum prevalence in questing I. scapularis nymphs (Swanson and Norris 2007). Given that coinfections with tick-borne pathogens can have mutualistic relationships (Diuk-Wasser et al. 2016, Cabezas-Cruz et al. 2018), the reduction of transmission probabilities where coinfections may occur will be an important facet of strategies aimed at reducing Lyme disease risk through nymphal burden reduction.

It is also important to consider the influence of non-target species (e.g., chipmunks, shrews, and squirrels) may have on not only estimates of infection prevalence, but also their contribution to pathogen maintenance and transmission. For example, Alghaferi et al. (2005) included small mammals such as eastern chipmunks (Tamias striatus) when determining prevalence of ospC-specific Borrelia in Maryland and Pennsylvania. The authors found 60% (71/118; CI = 5–69%) of small mammals contributed to overall prevalence. In our study, we opportunistically sampled 7 T. striatus which were captured and sampled. We found 4/6 (66.7%) T. striatus to be infected with Bo. burgdorferi s.s. When we include these mammals in the assemblage, prevalence at Centennial and David Force sites increase by 0.2% and 1%, respectively. Though it is not a substantial increase in our case, nonetheless, the increase suggests non-target host species can carry tick-borne pathogens in our study area and are likely contributing to enzootic pathogen maintenance.

Targeting stages where coinfection transmission events are more likely to occur can help reduce the potential for pathogen maintenance. Studies using 4-poster treatments or fipronil treated bait boxes have been successful at reducing tick abundances on the landscape (Schulze et al. 2017, Williams et al. 2018b). These two approaches target tick reduction at points where I. scapularis feed on their mammalian hosts (Fig. 4). Rodents and deer are the main contributors of A. phagocytophilum and rodents are commonly associated with Ba. microti and/or Bo. burgdorferi s.l. coinfections (Diuk-Wasser et al. 2010). Borrelia miyamotoi exhibits vertical as well as horizontal transmission (Rollend et al. 2013) and may co-occur with Ba. microti and/or Bo. burgdorferi s.l. (Diuk-Wasser et al. 2010, Hersh et al. 2014). Reducing opportunities for vectors, hosts, and pathogens to interact may help reduce tick-borne pathogen maintenance and eventually reduce the incidence of tick-borne infections in Maryland.

Acknowledgments

We thank Laura Beimfohr of USDA for her team management and data organization, Carson Coriell of USDA for his production of the GIS figure. We also thank Yasmine Hentati, Grace Hummell, and Patrick Roden-Reynolds of USDA for their fieldwork; Amy Fleshman of CDC for laboratory assistance. We also thank Scott Haynes, Cory Casal, Garrett Heck, Hannah Cornman, Zachary Vincent, Hayden Ward, Austin Haddock, and Loretta Bowman for their work on this project at the APHC laboratory. We also appreciate the review and helpful feedback from Drs. Rebecca Eisen and Paul Mead of CDC during manuscript preparation. This study was supported by the Areawide Pest Management Program awards from Office of National Programs, the United States Department of Agriculture (USDA) Agricultural Research Service (ARS) and funds from the USDA-ARS in-house project (8042–32000-008–00)—Prevention of Arthropod Bites.

Disclaimer: This article reports the results of research only. The findings and conclusions of this study are by the authors and do not necessarily represent the views of the Centers for Disease Control and Prevention (CDC). Mention of a proprietary product does not constitute an endorsement or a recommendation by the CDC or the USDA for its use. The USDA is an equal opportunity provider and employer.

References Cited

Alghaferi

, Anderson

, Park

, Auwaerter

, Aucott

, Norris

, and Dumler

. 2005. Borrelia burgdorferi ospC heterogeneity among human and murine isolates from a defined region of northern Maryland and southern Pennsylvania: lack of correlation with invasive and noninvasive genotypes. J. Clin. Microbiol 43: 1879–1884. doi:10.1128/JCM.43.4.1879-1884.2005.15815012

Amerasinghe

, Neidhardt

, Pagac

, and Scott

. 1993. Increasing density and Borrelia burgdorferi infection of deer-infesting Ixodes dammini (Acari: Ixodidae) in Maryland. J. Med. Entomol 30: 858–864.8254631

Anderson

, and Norris

. 2006. Genetic diversity of Borrelia burgdorferi sensu stricto in Peromyscus leucopus, the primary reservoir of Lyme disease in a region of endemicity in southern Maryland. Appl. Environ. Microbiol 72: 5331–5341. doi:10.1128/AEM.00014-06.16885284

Arsnoe

, Hickling

, Ginsberg

, McElreath

, and Tsao

. 2015. Different populations of blacklegged tick nymphs exhibit differences in questing behavior that have implications for human Lyme disease risk. PLoS ONE 10: e0127450. doi:10.1371/journal.pone.0127450.25996603

Arsnoe

, Tsao

, and Hickling

. 2019. Nymphal Ixodes scapularis questing behavior explains geographic variation in Lyme borreliosis risk in the eastern United States. Ticks Tick Borne Dis doi:10.1016/j.ttbdis.2019.01.001.

Bell

, and Patel

. 2005. A real-time combined polymerase chain reaction assay for the rapid detection and differentiation of Anaplasma phagocytophilum, Ehrlichia chaffeensis, and Ehrlichia ewingii. Diagn. Microbiol. Infect. Dis 53: 301–306.16263231

Brisson

, Dykhuizen

, and Ostfeld

. 2008. Conspicuous impacts of inconspicuous hosts on the Lyme disease epidemic. Proc. Biol. Sci 275: 227–235.18029304

Broström

, Jin

, and Holmberg

. 2020. Generalized linear models with clustering Available from https://cran.r-project.org/web/packages/glmmML/glmmML.

Cabezas-Cruz

, Pollet

, Estrada-Peña

, Allain

, Bonnet

, and Moutailler

. 2018. Handling the microbial complexity associated to ticks. IntechOpen doi:10.5772/intechopen.80511.

Carroll

, Hill

, Allen

, Young

, Miramontes

, Kramer

, Pound

, Miller

, and George

. 2009. The impact of 4-Poster deer self-treatment devices at three locations in Maryland. Vector Borne Zoonotic Dis 9: 407–416.19650735

CDC (Centers for Disease Control and Prevention). 2020. Lyme disease data tables: most recent year Available from https://www.cdc.gov/lyme/datasurveillance/tables-recent.html. Accessed 4 September 2020.

Cooley

1946. The genera Boophilus, Rhiphicephalus, and Haemaphysalis (Ixodidae) of the New World US Government Printing Office, Washington, DC. Nat Inst Health Bull No. 187.

Devleesschauwer

, Torgerson

, Charlier

, Levecke

, Praet

, Roelandt

, Smit

, Dorny

, Berkvens

, and Speybroeck

. 2015. Package ‘prevalence’ Available from http://prevalence.cbra.be/.izi.

Diuk-Wasser

, Vourc’h

, Cislo

, Hoen

, Melton

, Hamer

, Rowland

, Cortinas

, Hickling

, Tsao

, 2010. Field and climate-based model for predicting the density of host-seeking nymphal Ixodes scapularis, an important vector of tick-borne disease agents in the eastern United States. Global Ecol. Biogeogr 19: 504–514. doi:10.1111/j.1466-8238.2010.00526.x.

Diuk-Wasser

, Vannier

, and Krause

. 2016. Coinfection by Ixodes tick-borne pathogens: ecological, epidemiological, and clinical consequences. Trends Parasitol 32: 30–42. doi:10.1016/j.pt.2015.09.008.26613664

Drickamer

1990. Microhabitat preferences of two species of deermice Peromyscus in a northeastern United States deciduous hardwood forest. Acta Theriol 35: 241–252.

Dunn

, Krause

, Davis

, Vannier

, Fitzpatrick

, Rollend

, Belperron

, States

, Stacey

, Bockenstedt

, 2014. Borrelia burgdorferi promotes the establishment of Babesia microti in the northeastern United States. PLoS One 9: e115494.25545393

Eisen

, and Eisen

. 2018. Critical evaluation of the linkage between tick-based risk measures and the occurrence of Lyme disease cases. J. Med. Entomol 53: 1050–1062. doi:10.1093/jme/tjw092.

Eisen

, and Stafford

III. 2020. Barriers to effective tick management and tick-bite prevention in the United States (Acari: Ixodidae). J. Med. Entomol 57: doi: 10.1093/jme/tjaa079.

Fedele

, Poh

, Brown

, Jones

, Durden

, Tiffin

, Pagac

, Li

, and Machtinger

. 2020. Host distribution and pathogen infection of fleas (Siphonaptera) recovered from small mammals in Pennsylvania. J. Vector Ecol 45: 32–44.32492279

Fiset

, Tessier

, Millien

, and Lapointe

F-J

. 2015. Phylogeographic structure of the white footed mouse and the deer mouse, two Lyme disease reservoir hosts in Québec. PLoS One 10: e0144112. doi:10.1371/journal.pone.0144112.26633555

Gallo

, Fidin

, Lehrer

, and Magle

. 2017. Mammal diversity and metacommunity dynamics in urban green spaces: implications for urban wildlife conservation. Ecol. Appl 27: 2330–2341. doi:10.1002/eap.1611.28833978

Glass

, Schwartz

, Morgan

JM,

III, Johnson

, Noy

, and Israel

. 1995. Environmental risk factors for Lyme disease identified with geographic information systems. Am. J. Public Health 85: 944–948.7604918

Graham

, Pilgard

, Maes

, Hojgaard

, and Eisen

. 2016. Paired real-time PCR assays for detection of Borrelia miyamotoi in North American Ixodes scapularis and Ixodes pacificus (Acari: Ixodidae). Ticks Tick. Borne. Dis 7: 1230–1235.27475875

Graham

, Maes

, Hojgaard

, Fleshman

, Sheldon

, and Eisen

. 2018. A molecular algorithm to detect and differentiate human pathogens infecting Ixodes scapularis and Ixodes pacificus (Acari: Ixodidae). Ticks Tick Borne Dis 9: 390–403.29258802

Gusa

, Buller

, Storch

, Huycke

, Machado

, Slater

, Stockham

, and Massung

. 2001. Identification of a p28 gene in Ehrlichia ewingii: evaluation of gene for use as a target for a species-specific PCR diagnostic assay. J. Clin. Microbiol 39: 3871–3876.11682500

Hall

1981. The mammals of North America 2nd ed. John Wiley & Sons Inc., New York, NY.

Halsey

, Allan

, and Miller

. 2018. The role of Ixodes scapularis, Borrelia burgdorferi and wildlife hosts in Lyme disease prevalence: a quantitative review. Ticks Tick Borne Dis 9: 1103–1114. doi:10.1016/j.ttbdis.2018.04.006.29680260

Hersh

, Ostfeld

, McHenry

, Tibbetts

, Brunner

, Killilea

, LoGiudice

, Schmidt

, and Keesing

. 2014. Co-infection of blacklegged ticks with Babesia microti and Borrelia burgdorferi is higher than expected and acquired from small mammal hosts. PLoS One 9: e99348.24940999

Hofmeister

, Ellis

, Glass

, and Childs

. 1999. Longitudinal study of infection with Borrelia burgdorferi in a population of Peromyscus leucopus at a Lyme disease-enzootic site in Maryland. Am. J. Trop. Med. Hyg 60: 598–609.10348235

Horobik

, Keesing

, and Ostfeld

. 2006. Abundance and Borrelia burgdorferi-infection prevalence of nymphal Ixodes scapularis ticks along forest–field edges. EcoHealth 3: 262–268. doi:10.1007/s10393-006-0065-1.

Jackson

, Hilborn

, and Thomas

. 2006. Towards landscape design guidelines for reducing Lyme disease risk. Int. J. Epidemiol 35: 315–322.16394113

Jiang

, Stromdahl

, and Richards

. 2012. Detection of Rickettsia parkeri and Candidatus Rickettsia andeanae in Amblyomma maculatum Gulf Coast ticks collected from humans in the United States. Vector Borne Zoonotic Dis 12: 175–182.22022815

Johnson

, Graham

, Boegler

, Cherry

, Maes

, Pilgard

, Hojgaard

, Buttke

, and Eisen

. 2017. Prevalence and diversity of tick-borne pathogens in nymphal Ixodes scapularis (Acari: Ixodidae) in Eastern National Parks. J. Med. Entomol 54: 742–751.28028138

Keirans

, and Clifford

. 1978. The genus Ixodes in the United States: a scanning electron microscopestudy and key to the adults. J. Med. Entomol 15: 1–38. doi:10.1093/jmedent/15.suppl2.1.

Keirans

, and Litwak

. 1989. Pictorial key to the adults of hard ticks, family Ixodidae (Ixodia, Ixodoidea), east of the Mississippi River. J. Med. Entomol 26: 435–448.2795615

Kilpatrick

, Dobson

ADM

, Levi

, Salkeld

, Swei

, Ginsberg

, Kjemtrup

, Padgett

, Jensen

, Fish

, 2017. Lyme disease ecology in a changing world: consensus, uncertainty and critical gaps for improving control. Phil. Trans. R. Soc. B 372: 20160117. doi:10.1098/rstb.2016.0117.28438910

Leutenegger

, Pusterla

, Mislin

, Weber

, and Lutz

. 1999. Molecular evidence of coinfection of ticks with Borrelia burgdorferi sensu lato and the human granulocytic ehrlichiosis agent in Switzerland. J. Clin. Microbiol 37: 3390–3391.10488215

Loftis

, Massung

, and Levin

. 2003. Quantitative real-time PCR assay for detection of Ehrlichia chaffeensis. J. Clin. Microbiol 41: 3870–3872.12904406

Loftis

, Mixson

, Stromdahl

, Yabsley

, Garrison

, Williamson

, Fitak

, Fuerst

, Kelly

, and Blount

. 2008. Geographic distribution and genetic diversity of the Ehrlichia sp. from Panola Mountain in Amblyomma americanum. BMC Infect. Dis 8: 54.18433500

LoGiudice

, Ostfeld

, Schmidt

, and Keesing

. 2003. The ecology of infectious disease: effects of host diversity and community composition on Lyme disease risk. Proc. Natl. Acad. Sci. U. S. A 100: 567–571.12525705

Long

, Baldwin-Brown

, Tao

, Cook

, Balderrama-Gutierrez

, Corbett-Detig

, Mortazavi

, and Barbour

. 2019. The genome of Peromyscus leucopus, natural host for Lyme disease and other emerging infections. Sci. Adv 5: eaaw6441.31355335

Machtinger

, and Williams

. 2020. Practical guide to trapping Peromyscus leucopus and Peromyscus maniculatus for vector and vector-borne pathogen surveillance and ecology. J. Insect Sci 20: 5; 1–19. doi: 10.1093/jisesa/ieaa028.

Massung

, Slater

, Owens

, Nicholson

, Mather

, Solberg

, and Olson

. 1998. Nested PCR assay for detection of granulocytic ehrlichiae. J. Clin. Microbiol 36: 1090–1095.9542943

Modarelli

, Westrich

, Milholland

, Tietjen

, Castro-Arellano

, Medina

, and Esteve-Gasent

. 2020. Prevalence of protozoan parasites in small and medium mammals in Texas, USA. Int. J. Parasitol. Parasites Wildl 11: 229–234.32195108

Regnery

, Spruill

, and Plikaytis

. 1991. Genotypic identification of rickettsiae and estimation of intraspecies sequence divergence for portions of two rickettsial genes. J. Bacteriol 173: 1576–1589.1671856

Rollend

, Bent

, Krause

, Usmani-Brown

, Steeves

, States

, Lepore

, Ryan

, Dias

, Ben Mamoun

, 2013. Quantitative PCR for detection of Babesia microti in Ixodes scapularis ticks and in human blood. Vector Borne Zoonotic Dis 13: 784–790.24107203

Rosenberg

, Lindsey

, Fischer

, Gregory

, Hinckley

, Mead

, Paz-Bailey

, Waterman

, Drexler

, Kersh

, 2018. Vital signs: trends in reported vectorborne disease cases - United States and Territories, 2004–2016. Morb. Mortal. Wkly. Rep 67: 496–501.

Schulze

, Jordan

, Williams

, and Dolan

. 2017. Evaluation of the SELECT Tick Control System (TCS), a host-targeted bait box, to reduce exposure to Ixodes scapularis (Acari: Ixodidae) in a Lyme disease endemic area of New Jersey. J. Med. Entomol 54: 1019–1024. doi:10.1093/jme/tjx044.28399280

Simon

, Marrotte

, Desrosiers

, Fiset

, Gaitan

, Gonzalez

, Koffi

, Lapointe

F-J

, Leighton

, Lindsay

, 2014. Climate change and habitat fragmentation drive the occurrence of Borrelia burgdorferi, the agent of Lyme disease, at the northeastern limit of its distribution. Evol. Appl 7: 750–764. doi:10.1111/eva.12165.25469157

Stafford

III, Williams

, and Molaei

. 2017. Integrated pest management in controlling ticks and tick-associated diseases. J. Integr. Pest Manage 8: 28.

Straubinger

2000. PCR-Based quantification of Borrelia burgdorferi organisms in canine tissues over a 500-Day postinfection period. J. Clin. Microbiol 38: 2191–2199.10834975

Strickland

, Caisley

, Woubeshet

, and Israel

. 1994. Antibiotic therapy for Lyme disease in Maryland. Public Health Rep 109: 745–749.7800782

Stromdahl

, Jiang

, Vince

, and Richards

. 2011. Infrequency of Rickettsia rickettsii in Dermacentor variabilis removed from humans, with comments on the role of other human-biting ticks associated with spotted fever group Rickettsiae in the United States. Vector Borne Zoonotic Dis 11: 969–977.21142953

Stromdahl

, Sloan

, Eremeeva

, Miller

, Loftis

, and Pritt

. 2012. Detection of the Ehrlichia sp. Panola Moutain in Amblyomma americanum ticks using a groEL real-time PCR and melting temperature analysis. Proceedings, Poster Session 2. 25th Meeting of the American Society of Rickettsiology, 30 July 2012, Park City, UT.

Stromdahl

, Hamer

, Jenkins

, Sloan

, Williamson

, Foster

, Nadolny

, Elkins

, Vince

, and Pritt

. 2014. Comparison of phenology and pathogen prevalence, including infection with the Ehrlichia muris-like (EML) agent, of Ixodes scapularis removed from soldiers in the midwestern and the northeastern United States over a 15 year period (1997–2012). Parasit. Vectors 7: 553.25465046

Swanson

, Neitzel

, Reed

, and Belongia

. 2006. Coinfections acquired from Ixodes ticks. Clin. Microbiol. Rev 19: 708–727.17041141

Swanson

, and Norris

. 2007. Co-circulating microorganisms in questing Ixodes scapularis nymphs in Maryland. J. Vector Ecol 32: 243–251.18260514

Telford

III., 2018. Deer reduction is a cornerstone of integrated deer tick management. J. Integr. Pest Manage 8: 25.

Telford

III., Mather

, Moore

, Wilson

, and Spielman

. 1988. Incompetence of deer as reservoirs of the Lyme disease spirochete. Am. J. Trop. Med. Hyg 39: 105–109.3400797

Tonnetti

, Eder

, Dy

, Kennedy

, Pisciotto

, Benjamin

, and Leiby

. 2009. Transfusion-transmitted Babesia microti identified through hemovigilance. Transfusion 49: 2557–2563.19624607

Walter

, Carpi

, Evans

, Caccone

, and Diuk-Wasser

. 2016. Vectors as epidemiological sentinels: patterns of within-tick Borrelia burgdorferi diversity. PLoS Pathog 12: e1005759. doi:10.1371/journal.ppat.1005759.27414806

Williams

, Stafford

III., Molaei

, and Linske

. 2018a. Integrated control of nymphal Ixodes scapularis: effectiveness of white-tailed deer reduction, the entomopathogenic fungus Metrarhizium anisopliae, and fipronil-based rodent bait boxes. Vector Borne Zoonotic Dis 18: 55–64. doi:10.1089/vbz.2017.2146.29173127

Williams

, Little

EAH

, Stafford

III, Molaei

, and Linske

. 2018b. Integrated control of juvenile Ixodes scapularis parasitizing Peromyscus leucopus in residential settings in Connecticut, United States. Ticks Tick. Borne. Dis 9: 1310–1316.29859885

Zawada

, von Fricken

, Weppelmann

, Sikaroodi

, and Gillevet

. 2020. Optimization of tissue sampling for Borrelia burgdorferi in white-footed mice (Peromyscus leucopus). PLoS One 15: e0226798. doi:10.137/journal.pone.0226798.31978068

Fig. 1.

Tick species collected from drag-sampling parks in Howard County, Maryland, 2017.

Fig. 2.

Tick species collected from Peromyscus spp. rodents at parks in Howard County, Maryland, 2017.

Fig. 3.

Distribution and capture frequency of Borrelia burgdorferi sensu stricto-infected Peromyscus spp. rodents at suburban parks in Howard County, Maryland, 2017.

Fig. 4.

Fipronil treated bait boxes and four-poster acaricide applicators target critical steps in tick-borne pathogen circulation among Ixodes scapularis ticks, Odocoileus virginianus deer, and Peromyscus spp. rodent hosts.

Table 1.

Primers and probes included in the in-house multiplex PCR master mixes to detect Borrelia pathogens in rodent ear tissue

Target	Primers and probes	Sequence 5′−3′	Size (bp)	Reference	Final concentration (μM)
M76 master mix
Bo. burgdorferi sensu stricto (oppA2 gene)	Bb-F	AATTTTTGGTTCCATACCC	162	Graham et al. 2018	0.45
Bo. mayonii (oppA2 gene)	Bmayo-F	GCCCGATTTAATCAAAGA	144	Graham et al. 2018	0.45
	Bb/Bmayo-R	CTGTCAATAGCAAGAGTTAA		Graham et al. 2018	0.9
	Bb-Probe	HEX-CGTTCAATACACACATCAAACCACT-BHQ1		Graham et al. 2018	0.2
	Bmayo-Probe	FAM-ACACGCACATTAAACCGCTTGAT-BHQ1		Graham et al. 2018	0.2
Bo. miyamotoi (purB gene)	purB_F	TCCTCAATGATGAAAGCTTTA	121	Graham et al. 2016	0.3
	purB_R	GGATCAACTGTCTCTTTAATAAAG		Graham et al. 2016	0.3
	purB_Probe	CalRD610-TCGACTTGCAATGATGCAAAACCT-BHQ2		Graham et al. 2016	0.2
M78 master mix
Bo. burgdorferi sensu lato (chromosomal DNA)	Bbsl_F	CCCAAAGCAGGTGCCTTAGC	78	This study	0.3

	Bbsl_R	TCTGTAGGTTTTAGGTTCGAGTCC		This study	0.3
	Bbsl_probe	AGGCCACATCCCGAATGAAGCGCA		This study	0.2
Bo. miyamotoi (glpQ gene)	glpQ_F	GACCCAGAAATTGACACAACCACAA	108	Graham et al. 2016	0.3
	glpQ_R	TGATTTAAGTTCAGTTAGTGTGAAGTCAGT		Graham et al. 2016	0.3
	glpQ_Probe	CalRd610-CAATCGAGCTAGAGAAAACGGAAGATATTACG-BHQ2		Graham et al. 2016	0.2
GAPDH				Rodent GAPDH Control Reagents kit	0.2/0.2

BHQ1 and BHQ2: Black Hole Quencher 1 and 2, respectively; CalRd610: CalFluor Red 610; FAM, 6-Carboxyfluorescein; HEX, Hexachloro-Fluorescein Phosphoramidite.

Table 2.

Pathogen infection status of ticks collected by drag-sampling at parks in Howard County, Maryland, 2017

Site	Total ticks	Amblyomma americanum		Dermacentor spp.	Ixodes scapularis				Pathogen prevalence (%; CI)^a
Site	Total ticks	Nymphs	Adults (♂/♀)	Adults (♂/♀)	Nymphs	Adults (♂/♀)	NIP (±SE)	D	Borrelia burgdorferi s.l.	Anaplasma phagocytophilum	Ehrlichia chaffeensis
Blandair	10	1	-	1 (1/0)^a	7	1 (1/0)	2 (0.3)	0.00001	-	-	-
Cedar Lane	19	2	-	1 (1/0)^v	9	7 (3/4)	3 (0.3)	0.00003	6/16 (38; 18–62)	-	-
Centennial	19	0	-	1 (0/1)^a	15	3 (2/1)	3 (1.3)	0.00003	5/18 (28; 13–51)	1/18 (6; 1–26)	-
David Force	12	0	-	1 (1/0)^a	10	1 (1/0)	2 (0.3)	0.00002	3/10 (30; 11–61)	1/11 (9; 2–38)	-
MPEA	26	0	1 (0/1)	-	18	7 (4/3)	4 (1.4)	0.00004	2/25 (8; 3–25)	-	-
Rockburn	58	15	2 (2/0)	-	34	7 (5/2)	6 (2.3)	0.00006	7/41 (17; 9–31)	1/58 (2; <1–9)	-
Wincopin	63	37	7 (4/3)	-	17	2 (1/1)	4 (0.9)	0.00003	-	1/63 (2; <1–8)	1/44 (2; <1–12)

NIP = mean number of nymphs collected per sampling date during May–July; D = nymphal density during May–July per 100 m².

A. americanum were tested for A. phagocytophilum and Ehrlichia spp.; D. albipictus (a) and D. variablilis (v) were tested for Rickettsia spp.; I. scapularis were tested for A. phagocytophilum, Ba. microti, and Bo. Burgdorferi s.l.

Table 3.

Ixodes scapularis ticks removed from Peromyscus spp. rodents at Howard County, Maryland parks, 2017

Site	No. mice examined	Infested mice^a (%)	Tick burden^b	No. nymphs collected	Infection prevalence in nymphs (%; CI)
Site	No. mice examined	Infested mice^a (%)	Tick burden^b	No. nymphs collected	Anaplasma phagocytophilum	Borrelia burgdorferi s.l
Blandair	88	39/88 (44)	2.3 (89/39)	15	2/15 (13; 4–39)	12/15 (80; 54–93)
Cedar Lane	43	25/43 (58)	5.0 (126/25)	4	-	-
Centennial	42	17/42 (40)	2.9 (49/17)	6	-	3/6 (50; 19–82)
David Force	78	55/78 (70)	4.2 (229/55)	39	4/39 (10; 4–23)	26/39 (67; 51–79)
MPEA	31	13/31 (41)	1.5 (48/31)	7	-	5/7 (71; 35–91)
Rockburn	40	20/40 (50)	2.8 (56/20)	6	-	5/6 (83; 45–96)
Wincopin	8	3/8 (38)	1.7 (5/3)	3	-	3/3 (100; 47–100)

% of rodents with I. scapularis ticks.

Mean number of ticks per rodent host; pathogens tested include Anaplasma phagocytophilum and Borrelia burgdorferi s.l.

Table 4.

Parameter estimates for a generalized linear mixed-effects model estimating the likelihood of captured rodents to carry a Borrelia burgdorferi s.l.-infected Ixodes scapularis across an edge-forest gradient

Parameter	Coefficient	SE	z	P
Intercept	0.71	0.78	0.91	0.36
Spring	−0.75	0.76	−0.98	0.33
Summer	−1.33	0.71	−1.87	0.06
Mid-forest	−0.64	0.38	−1.68	0.09
Deep forest	−0.54	0.37	−1.48	0.14
Burden	0.15	0.06	2.36	0.02
Nymph	1.31	0.47	2.79	<0.01

Table 5.

Infection prevalence of Peromyscus spp. rodents captured at Howard County, Maryland parks, 2017

			Infection prevalence (%; CI)				Coinfection prevalence (%; CI)
Site	n _m	n _r	Anaplasma phagocytophilum	Babesia microti	Borrelia burgdorferi s.l.	Borrelia miyamotoi	Anaplasma and Bo. burgdorferi	Babesia and Bo. burgdorferi	Bo. Burgdorferi and Bo. miyamotoi
			3/88 (3; 1–9)	-	55/88 (63; 52–72)	3/88 (3; 1–10)	3/88 (3; 1–10)	-	3/88 (3; 1–10)
Cedar Lane	43	37	-	-	18/43 (42; 28–57)	1/43 (2; <1–12)	-	-	1/43 (2; <1–12)
Centennial	42	35	-	-	23/42 (55; 40–69)	1/42 (2; 1–12)	-	-	1/42 (2; 1–12)
David Force	78	66	33/78 (42; 32–53)	-	61/78 (78; 68–86)	2/78 (3; 1–9)	31/78 (40; 30–51)	2/78 (3; 1–9)	-
MPEA	31	23	2/31 (6; 2–21)	1/31 (3; <1–17)	11/31 (35; 21–86)	-	2/31 (6; 2–21)	1/31 (3; 1–17)	-
Rockburn	40	28	-	-	23/40 (58; 42–72)	-	-	-	-
Wincopin	8	0	-	-	3/8 (38; 14–70)	-	-	-	-

n_m = total number of individual mice examined; n_r = number of recaptured individuals examined.