Multispacer sequence typing is the first reliable method for typing
Previous studies have shown that
Several other methods have been used to type different isolates of the same species, in particular, multilocus enzyme electrophoresis (
Recently, the whole genome of the
The
The whole genome of
| Spacer name | ORF | Nucleotide sequence (5´–3´)* | Amplified fragment length (bp) |
|---|---|---|---|
| Cox2 | Hypothetical protein | Cox20766 CAACCCTGAATACCCAAGGA | 397 |
| Hypothetical protein | Cox21004 GAAGCTTCTGATAGGCGGGA | ||
| Cox5 | Sulfatase domain protein | Cox77554 CAGGAGCAAGCTTGAATGCG | 395 |
| Entericidin, putative | Cox77808 TGGTATGACAACCCGTCATG | ||
| Cox18 | Ribonuclease H | Cox283060 CGCAGACGAATTAGCCAATC | 557 |
| DNA polymerase III, epsilon subunit | Cox283490 TTCGATGATCCGATGGCCTT | ||
| Cox20 | Hypothetical protein | Cox365301 GATATTTATCAGCGTCAAAGCAA | 631 |
| Hypothetical protein | Cox365803 TCTATTATTGCAATGCAAGTGG | ||
| Cox22 | Hypothetical protein | Cox378718 GGGAATAAGAGAGTTAGCTCA | 383 |
| Amino acid permease family protein | Cox378965 CGCAAATTTCGGCACAGACC | ||
| Cox37 | Hypothetical protein | Cox657471 GGCTTGTCTGGTGTAACTGT | 463 |
| Hypothetical protein | Cox657794 ATTCCGGGACCTTCGTTAAC | ||
| Cox51 | Replicative DNA helicase, intein-containing | Cox824598 TAACGCCCGAGAGCTCAGAA | 674 |
| Conserved hypothetical protein – Uridine kinase | Cox825124 GCGAGAACCGAATTGCTATC | ||
| Cox56 | OmpA-like transmembrane domain protein | Cox886418 CCAAGCTCTCTGTGCCCAAT | 479 |
| Conserved hypothetical protein | Cox886784 ATGCGCCAGAAACGCATAGG | ||
| Cox57 | Rhodanese-like domain protein | Cox892828 TGGAAATGGAAGGCGGATTC | 617 |
| Hypothetical protein | Cox893316 GGTTGGAAGGCGTAAGCCTTT | ||
| Cox 61 | Dioxygenase, putative | Cox956825 GAAGATAGAGCGGCAAGGAT | 611 |
| Hypothetical protein | Cox957249 GGGATTTCAACTTCCGATAGA |
*The numbers are beginning or end locations of the genes where the primers were chosen.
PCR products were cloned in PGEM-T Easy Vector (Promega, Charbonnières, France) according to the manufacturer's instructions. Ten clones were cultivated in LB medium (USB, Cleveland, OH, USA) overnight, and PCR and sequencing were performed as described previously.
PCR for QpH1 and QpRS sequence plasmids were performed with the primers previously described QpH11/12 and QpRS01/02 (
Statistical analyses were performed by using the chi-square test in the program EpiInfo 6 (
Initially 14 isolates were chosen to test the genetic diversity of the spacers: Nine Mile, Priscilla, Q212, Heizberg, Brasov, Dog ut Ad, CB15, CB20, CB26, CB28, CB33, CB35, CB114, and CB115. We chose 68 spacers, but we retained only 51 spacers for which PCR amplification was obtained for all the isolates. We kept 10 spacers (Cox2, Cox5, Cox18, Cox20, Cox22, Cox37, Cox51, Cox56, Cox57, and Cox61) (
| COX | 2 | 5 | 18 | 20 | 22 | 37 | 51 | 56 | 57 | 61 |
|---|---|---|---|---|---|---|---|---|---|---|
| ST | ||||||||||
| 1 | 5 | 6 | 3 | 4 | 6 | 5 | 8 | 1 | 5 | 6 |
| 2 | 5 | 6 | 3 | 5 | 6 | 5 | 8 | 1 | 5 | 6 |
| 3 | 5 | 6 | 3 | 4 | 6 | 7 | 8 | 1 | 5 | 6 |
| 4 | 5 | 6 | 3 | 2 | 6 | 5 | 8 | 1 | 5 | 6 |
| 5 | 4 | 6 | 3 | 5 | 6 | 2 | 8 | 2 | 5 | 6 |
| 6 | 4 | 3 | 3 | 5 | 6 | 5 | 8 | 2 | 5 | 6 |
| 7 | 4 | 6 | 3 | 5 | 6 | 5 | 8 | 2 | 5 | 6 |
| 8 | 5 | 4 | 2 | 5 | 1 | 5 | 3 | 3 | 4 | 4 |
| 9 | 1 | 4 | 2 | 5 | 1 | 5 | 2 | 3 | 4 | 6 |
| 10 | 5 | 4 | 2 | 5 | 1 | 5 | 2 | 3 | 2 | 6 |
| 11 | 6 | 5 | 1 | 6 | 5 | 4 | 5 | 4 | 3 | 2 |
| 12 | 3 | 5 | 1 | 6 | 5 | 4 | 5 | 4 | 3 | 2 |
| 13 | 3 | 5 | 1 | 6 | 5 | 4 | 5 | 5 | 3 | 2 |
| 14 | 7 | 5 | 1 | 6 | 5 | 6 | 9 | 4 | 3 | 2 |
| 15 | 7 | 5 | 1 | 6 | 5 | 6 | 9 | 6 | 3 | 2 |
| 16 | 3 | 7 | 5 | 3 | 4 | 1 | 6 | 7 | 6 | 5 |
| 17 | 3 | 7 | 5 | 7 | 4 | 1 | 10 | 8 | 6 | 7 |
| 18 | 3 | 7 | 1 | 6 | 3 | 4 | 7 | 9 | 6 | 3 |
| 19 | 3 | 2 | 7 | 8 | 5 | 4 | 11 | 9 | 6 | 5 |
| 20 | 3 | 2 | 6 | 1 | 5 | 4 | 4 | 10 | 6 | 5 |
| 21 | 2 | 1 | 4 | 6 | 2 | 3 | 1 | 11 | 1 | 1 |
| 22 | 3 | 7 | 1 | 6 | 3 | 8 | 7 | 9 | 6 | 8 |
| 23 | 3 | 7 | 1 | 6 | 3 | 8 | 7 | 9 | 6 | 3 |
| 24 | 3 | 5 | 1 | 6 | 5 | 4 | 5 | 12 | 3 | 9 |
| 25 | 3 | 7 | 1 | 6 | 3 | 4 | 7 | 9 | 7 | 3 |
| 26 | 9 | 4 | 8 | 5 | 8 | 5 | 2 | 3 | 4 | 6 |
| 27 | 3 | 5 | 1 | 6 | 5 | 4 | 5 | 12 | 3 | 2 |
| 28 | 8 | 4 | 8 | 5 | 7 | 5 | 2 | 3 | 4 | 6 |
| 29 | 3 | 7 | 1 | 9 | 3 | 4 | 7 | 9 | 6 | 3 |
| 30 | 5 | 6 | 9 | 5 | 6 | 5 | 8 | 13 | 8 | 6 |
The nucleotide sequence accession numbers are noted in
The dendrogram in the
Dendrogram of the genetic relatedness among the 30 different sequence types defined by multispacer sequence type (MST) analysis. The dendrogram was constructed by unweighted pair-group method with arithmetic mean. Plasmid sequence type,
The second group included isolates from Europe (France, Germany, Switzerland, Romania, Italy, Greece, Austria, Slovakia), the United States, Russia, Africa (Central Africa and Senegal), and Asia (Kazakhstan, Uzbekistan, Mongolia, and Japan). It was divided into 4 subgroups. The first one included 26 isolates, which represented 7 different STs (ST11, ST12, ST13, ST14, ST15, ST24, and ST27). The second subgroup included 34 isolates that were included in ST18, ST22, ST23, ST25, and ST29 groups. The third subgroup included 18 isolates (ST16 and ST17), and the fourth subgroup included 10 isolates (ST19 and ST20).
The third group consisted of only 1 ST, ST21, and included the 7 Canadian isolates, 2 isolates from France (CB4 and CB7), and 1 isolate from the United States (Scurry). The clusters determined by the BURST algorithm were consistent with those determined by the phylogenetic analysis. Five groups were defined. The first one included ST1 to ST7; the putative ancestral genotype in this group was ST1. ST8 (putative ancestral genotype), ST9, ST10, ST26, and ST28 were included in the second group; ST11, ST12 (putative ancestral genotype), ST13, ST14, ST15, and ST24 in the third group, ST16 and ST17 in the fourth group; and ST18 (putative ancestral genotype), ST22, ST23, ST25, and ST29 in the fifth group. ST19, ST20, ST21, and ST30 were considered as singletons.
In the monophyletic group 1, the sequence of plasmid QpRS was found for isolates included in ST4, ST5, ST6, ST7, ST8, ST9, ST10, ST26, ST28, and ST30. The QpDV plasmid sequence was amplified for isolates included in ST1, ST2, ST3, and ST4. In the monophyletic group 2, the QpH1 plasmid sequence was found in all the isolates. In the monophyletic group 3, the QpH1 plasmid sequence or none of the searched plasmid sequences was detected. Sequence comparison of
QpDV plasmid presence in human isolates was correlated with the acute form of the disease (p = 2 × 10–7), and QpRS plasmid presence was correlated with the chronic form of the disease (p = 2 × 10–4). The acute form of the disease was correlated with ST1 (p = 10–3), ST4 (p = 7 × 10–4) ST16 (p = 3 × 10–3), ST18 (p = 10–2), and the chronic form of the disease was correlated with ST8 (p = 2 × 10–3).
As primers were chosen in ORFs surrounding the studied spacers, mutations, deletions, or insertions were noted in the protein sequences. Mutations were noted in the hypothetical protein (gi29653385) for ST11; in the hypothetical protein (gi29653385) for ST9 and ST26; in entericin (gi29653446) for ST20, in ribonuclease H (gi29653667) in ST1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 21, 26, 28, and 30; in amino acid permease family protein (gi29653908) in ST28; in hypothetical protein (gi29654047) in ST1, 2, 4, 5, 6, 7, 8, 9, 10, 26, 28, and 30. In CB118 (ST3), a stop codon appeared which shortened the length of the ORF. Mutations were noted in uridine kinase (gi29654198) in ST18, ST22, ST23, ST25, and ST29; in ompA-like transmembrane domain protein (gi29654257), in ST20; in rhodanese-like domain protein (gi29654263) in ST20 (the protein was longer by 2 amino acids); in dioxygenase (gi29654325) in ST21 and ST22; in hypothetical protein (gi29732244), in ST17.
Insertions or deletions were noted in hypothetical protein (gi29653386) in ST5, 6, and 7; in hypothetical protein (gi29653755) in ST1 and ST3 (insertion of a base G in the DNA sequence made the protein sequence longer of 22 amino acids); in the amino acid permease family protein (gi29653772) in ST8, 9, and 10 (deletion of a base A in the DNA sequence made the protein sequence longer of 24 amino acids); in ompA-like transmembrane domain protein (gi29654257) in ST11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 22, 23, 24, 25, 27, and 29.
Q fever in humans and animals, caused by
Molecular methods are now almost universally used to characterize strains and to determine the relatedness between isolates causing diseases in different contexts. The most discriminative approach used for
Most of the French isolates were included in monophyletic group 1. Nineteen were included in ST1, and 24 were included in ST8. Thus, an isolate has a geographic distribution even if genetic modifications appear (insertions, deletions or mutations) over time, giving rise to a new ST that is related to the ancestor isolate. This fact was highlighted when the analysis of the STs was performed by using the BURST algorithm. ST1 and ST8 were described as the ancestral genotypes and for example, ST9 and ST10 corresponded to SLVs of ST8 (isolates that differ at only 1 of the 7 loci) and ST26 and ST28 corresponded to DLVs of ST8 (double locus variants). But some types were not delineated on the basis of geographic origin because they were isolated from different parts of the world. This distribution in distant countries is likely related to movements of infected patients, animals, or ticks. This is particularly true for ST16 isolates that were encountered on 4 different continents, America, Europe, Asia, and Africa. The homology of the Canadian isolates from Nova Scotia should be noted. Q fever is just as endemic in Nova Scotia as in France. This may indicate rapid and recent spreading of a single strain. The association between ST21 and Canada is significant as tested with the chi-square test with a Fisher value <10–8. Notably, patient CB115, who had Q fever endocarditis, was living in Edmonton, Alberta (≈3,000 miles from Nova Scotia) when this illness was diagnosed. He grew up in Nova Scotia, and the molecular epidemiologic findings show that he acquired his disease there. Q fever is uncommon in Alberta. Most of the STs are found in Europe. A sample bias could exist as most of the isolates tested were from this continent, but the results obtained may also indicate that
Concordant results were found when MST was compared with
This study showed a correlation between QpDV and acute infections, between QpRS and chronic infections, and an association between some genotypes and disease type. A bias in sampling exists since acute disease is 20 times more frequent than chronic disease, but in this study, most of the human isolates were from chronic disease patients, and the isolates from acute infections were mainly obtained from France. These facts reflect the difficulty in isolating the bacteria. A genomic typing method such as MST could be applied directly to samples to obtain a more precise idea of how
Comparison of DNA sequences is the best approach to investigate bacterial evolution. MLST in association with BURST analysis has been used to type isolates of many species. But this method is useful only if housekeeping gene diversity exists in the studied species. For example, in the species
Dr. Glazunova and Dr. Roux contributed equally to this work.
We are grateful to Marie-Laure Birg and Jean-Yves Patrice for their technical assistance in culture of
This work was supported by a grant from the French Ministry of Research (ACI Microbiologie 2003) and a grant of the Pasteur Institute (2003-11).
| Isolate | Origin | Disease, symptoms, clinical status | Geographicsource | ST (sequence type) | Plasmid sequence type |
|---|---|---|---|---|---|
| CB108 | Human blood | Acute | Marseille, France, 2001 | 1 | QpDV |
| CB1 | Human heart valve | Chronic | Istres, France, 1989 | 1 | QpDV |
| CB3 | Human heart valve | Chronic | Marseille, France | 1 | QpDV |
| CB36 | Human placenta | Abortion | Martigues, France, 1992 | 1 | QpDV |
| CB38 | Human blood | Acute | Marseille, France, 1992 | 1 | QpDV |
| CB41 | Human heart valve | Chronic | Marseille, France, 1993 | 1 | QpDV |
| CB60 | Human blood | Acute | Marseille, France, 1996 | 1 | QpDV |
| CB63 | Human heart valve | Chronic | Marseille, France, 1994 | 1 | QpDV |
| CB75 | Human blood | Chronic | Marseille, France, 1998 | 1 | QpDV |
| CB82 | Human blood | Acute | Marseille, France, 1999 | 1 | QpDV |
| CB86 | Human blood | Chronic | Marseille, France, 1999 | 1 | QpDV |
| CB87 | Human placenta | Abortion | Martigues, France, 1999 | 1 | QpDV |
| CB89 | Human placenta | Abortion | Martigues, France, 2000 | 1 | QpDV |
| CB94 | Human blood | Acute | Aix en Provence, France, 2000 | 1 | QpDV |
| CB97 | Human blood | Acute | Marseille, France, 2000 | 1 | QpDV |
| CB110 | Human blood | Chronic | Marseille, France, 2002 | 1 | QpDV |
| CB28 | Human blood | Acute | Salon de Provence, France, 1992 | 1 | QpDV |
| CB26 | Human blood | Acute | Marseille, France, 1992 | 1 | QpDV |
| CB64 | Human blood | Acute | Martigues, France, 1996 | 1 | QpDV |
| CB39 | Human blood | Acute | Marseille, France, 1992 | 2 | QpDV |
| RT-1140 | Human blood | Pneumonia | Krimea, Ukrain 1954 | 2 | QpDV |
| RT-Schperling | Human blood | Fever | Kyrgyzstan, 1955 | 2 | QpDV |
| CB118 | Human heart valve | Chronic | Marseille, France, 2004 | 3 | QpDV |
| CB62 | Human blood | Acute | Martigues, France, 1996 | 4 | QpDV |
| CB20 | Human blood | Acute | Salon de Provence, France, 1991 | 4 | QpRS |
| CB51 | Human placenta | Abortion | Madrid, Spain, 1996 | 4 | QpDV |
| CB12 | Human blood | Acute | Aix en Provence, France | 4 | QpDV |
| CB57 | Human blood | Acute | Martigues, France, 1996 | 4 | QpDV |
| CB54 | Human blood | Acute | Aix en Provence, France, 1996 | 4 | QpDV |
| CB111 | Human heart valve | Chronic | Marseille, France, 2003 | 5 | QpRS |
| CB35 | Human heart valve | Chronic | Paris, France, 1992 | 5 | QpRS |
| CB45 | Human heart valve | Chronic | Paris, France, 1993 | 6 | QpRS |
| CB43 | Human heart valve | Chronic | Paris, France, 1993 | 7 | QpRS |
| Leningrad-2 | Human blood | - | Leningrad, Russia, 1955 | 7 | QpRS |
| Leningrad-4 | Human blood | - | Leningrad, Russia, 1957 | 7 | QpRS |
| CB10 | Human heart valve | Chronic aneurysm | Grenoble, France | 8 | QpRS |
| CB9 | Human blood | Chronic | Lyon, France | 8 | QpRS |
| CB31 | Human heart valve | Chronic | Marseille, France, 1992 | 8 | QpRS |
| CB34 | Human blood | Chronic | Marseille, France, 1992 | 8 | QpRS |
| CB44 | Human heart valve | Chronic | Créteil, France, 1993 | 8 | QpRS |
| CB53 | Aneurysm | Chronic | Marseille, France, 1995 | 8 | QpRS |
| CB61 | Valvular prosthesis | Chronic | Marseille, France, 1996 | 8 | QpRS |
| CB70 | Human heart valve | Chronic | Grenoble, France, 1997 | 8 | QpRS |
| CB71 | Valvular prosthesis | Chronic | Saint-Laurent du Var, France, 1997 | 8 | QpRS |
| CB73 | Valvular prosthesis | Chronic | Marseille, France, 1998 | 8 | QpRS |
| CB81 | Human heart valve | Chronic | Madrid, Spain, 1999 | 8 | QpRS |
| CB91 | Valvular prosthesis | Chronic | Marseille, France, 2000 | 8 | QpRS |
| CB93 | Human placenta | Abortion | Dreux, France, 2000 | 8 | QpRS |
| CB95 | Human blood | Chronic | Marseille, France, 2000 | 8 | QpRS |
| CB116 | Aneurysm | Chronic | Marseille, France, 2003 | 8 | QpRS |
| CB107 | Human heart valve | Chronic | Tours, France, 2001 | 8 | QpRS |
| CB96 | Human heart valve | Chronic | Marseille, France, 2000 | 8 | QpRS |
| CB114 | Human heart valve | Chronic | Marseille, France, 2003 | 8 | QpRS |
| CB15 | Human heart valve | Chronic | Lyon, France, 1991 | 8 | QpRS |
| CB47 | Human heart valve | Chronic | Barcelone, Spain, 1994 | 8 | QpRS |
| CB99 | Human heart valve | Chronic | Marseille, France, 2000 | 8 | QpRS |
| CB106 | Human heart valve | Chronic | Toulouse, France, 2001 | 8 | QpRS |
| CB79 | Human heart valve | Chronic | Paris, France, 1999 | 8 | QpRS |
| CB98 | Human heart valve | Chronic | Marseille, France, 2000 | 8 | QpRS |
| CB83 | Goat placenta | Abortion | Newfoundland, USA, 1999 | 8 | QpRS |
| CB8 | Human heart valve | Chronic | Marseille, France, 1990 | 8 | QpRS |
| Priscilla | Aborted goat | Abortion | Montana, USA, 1980 | 8 | QpRS |
| CB117 | Human heart valve | Chronic | Marseille, France, 2004 | 8 | QpRS |
| CB32 | Human heart valve | Chronic | Lyon, France, 1992 | 9 | QpRS |
| CB92 | Human heart valve | Chronic | Marseille, France, 2000 | 9 | QpRS |
| CB68 | Pigeon excrement | – | Marseille, France, 1996 | 9 | QpRS |
| CB49 | Human heart valve | Chronic | Marseille, France, 1994 | 9 | QpRS |
| CB65 | Human heart valve | Chronic | Marseille, France, 1996 | 10 | QpRS |
| CB103 | Ewe placenta | Abortion | Marseille, France, 2001 | 10 | QpRS |
| CB13 | Human blood | Chronic | Paris, France | 11 | QpH1/QpDV |
| CB40 | Human heart valve | Chronic | Paris, France, 1993 | 11 | QpH1 |
| CB46 | Valvular prosthesis | Chronic | Paris, France, 1993 | 11 | QpH1 |
| CB5 | Human blood | Chronic | Paris, France, 1990 | 12 | QpH1 |
| CB6 | Human blood | Chronic | Paris, France | 12 | QpH1 |
| CB42 | Valvular prosthesis | Chronic | Toulouse, France, 1993 | 12 | QpH1 |
| CB52 | Valvular prosthesis | Chronic | Paris, France, 1995 | 12 | QpH1 |
| CB56 | Human heart valve | Chronic | Paris, France, 1996 | 12 | QpH1 |
| CB58 | Spleen abscess | – | Lyon, France, 1996 | 12 | QpH1 |
| CB76 | Human heart valve | Chronic | Paris, France, 1998 | 12 | QpH1 |
| CB105 | Human heart valve | Chronic | Montpellier, France, 2001 | 12 | QpH1 |
| CB112 | Human heart valve | Chronic | Zurich, Switzerland, 2003 | 12 | QpH1 |
| CB109 | Human heart valve | Chronic | Berlin, Germany, 2002 | 12 | QpH1 |
| CB113 | Goat placenta | Abortion | Albi, France, 2003 | 12 | QpH1 |
| CB33 | Human heart valve | Chronic | Clermont-Ferrand, France, 1992 | 12 | QpH1 |
| CB55 | Vegetation | Chronic | Paris, France, 1996 | 12 | QpH1 |
| CB2 | Human blood | Immunodepression | Toulouse, France, | 13 | QpH1 |
| CB69 | Vegetation | Chronic | Toulouse, France, 1996 | 13 | QpH1 |
| CB85 | Human blood | Chronic | Tours, France, 1999 | 14 | QpH1 |
| CB74 | Valvular prosthesis | Chronic | Toulouse, France, 1998 | 14 | QpH1 |
| CB59 | Aneurysm | Chronic aneurysm | Saint-Etienne, France, 1996 | 14 | QpH1 |
| CB80 | Node | Chronic | Niort, France, 1999 | 14 | QpH1 |
| Z3055 | Ewe placenta | Abortion | Germany | 14 | QpH1 |
| CB102 | Valvular prosthesis | Chronic | Poitiers, France, 2001 | 15 | QpH1 |
| CB11 | Human blood | Acute | Marseille, France | 16 | QpH1 |
| CB23 | Human blood | Chronic | Clermont-Ferrand, France, 1988 | 16 | QpH1 |
| Brasov | Human | Acute | Romania | 16 | QpH1 |
| Bangui | Human blood | Acute | Central Africa | 16 | QpH1 |
| California | Cow milk | Persistent | California, USA, 1947 | 16 | QpH1 |
| CB25 | Human blood | Acute | Paris, France, 1991 | 16 | QpH1 |
| Dyer | Human blood | Acute | USA, 1938 | 16 | QpH1 |
| Ohio | Cow milk | Persistent | Ohio, USA, 1956 | 16 | QpH1 |
| Nine Mile | Tick | – | Montana, USA, 1935 | 16 | QpH1 |
| CS-KL 9 | Ixodes ricinus | – | Slovakia, 1989 | 16 | QpH1 |
| Z-2775/90 | Cow placenta | Abortion | Germany, 1990 | 16 | QpH1 |
| J-1 | Cow milk | – | Japan | 16 | QpH1 |
| J-3 | Cow milk | – | Japan | 16 | QpH1 |
| J-27 | Cow milk | – | Japan | 16 | QpH1 |
| J-60 | Cow milk | – | Japan | 16 | QpH1 |
| J-82 | Cow milk | – | Japan | 16 | QpH1 |
| Hardthof | Cow milk | – | Germany, 1990 | 16 | QpH1 |
| CB77 | Human heart valve | Chronic | Paris, France, 1998 | 17 | QpH1 |
| CB100 | Human blood | Chronic | Strasbourg, France | 18 | QpH1 |
| Henzerling | Human blood | Acute | Italy/Slovakia, 1945 | 18 | QpH1 |
| Balaceanu | Human | Acute | Romania | 18 | QpH1 |
| Geier | Human | Acute | Romania | 18 | QpH1 |
| Heizberg | Human | Acute | Greece | 18 | QpH1 |
| Cs-Florian | Human blood | – | Slovakia, 1956 | 18 | QpH1 |
| Z-3464/92 | Goat placenta | Abortion | Germany, 1992 | 18 | QpH1 |
| Z-4488/93 | Ewe placenta | Abortion | Germany, 1993 | 18 | QpH1 |
| Z-349-36/94 | Ewe placenta | – | Germany, 1994 | 18 | QpH1 |
| München | Sheep | – | München, Germany, 1969 | 18 | QpH1 |
| CB119 | Human heart valve | Chronic | Senegal, 2004 | 19 | QpH1 |
| CB48 | Human placenta | Abortion | Grenoble, France, 1994 | 20 | QpH1 |
| CB50 | Valvular prosthesis | Chronic | Paris, France, 1994 | 20 | QpH1 |
| CB66 | Aneurysm | Chronic aneurysm | Marseille, France, 1996 | 20 | QpH1 |
| CB72 | Valvular prosthesis | Chronic | Paris, France, 1996 | 20 | QpH1 |
| CB78 | Valvular prosthesis | Chronic | Marseille, France, 1998 | 20 | QpH1 |
| CB88 | Human heart valve | Chronic | Lyon, France, 1999 | 20 | QpH1 |
| CB90 | Human heart valve | Chronic | Lyon, France,2000 | 20 | QpH1 |
| Z-3567/92 | Cow placenta | Abortion | Germany, 1992 | 20 | QpH1 |
| Dugway 5J108-111 | Rodent | – | Utah, USA, 1958 | 20 | QpH1 |
| CB4 | Human blood | Chronic | Montpellier, France,1988 | 21 | QpH1 |
| CB7 | Human heart valve | Chronic Aneurysm | Marseille, France | 21 | QpH1 |
| Q229 | Human heart valve | Chronic | Nova Scotia, Canada, 1982 | 21 | QpH1 |
| Dog CB | Dog uterus | – | Nova Scotia, Canada, 1995 | 21 | |
| Poker Cat | Cat | – | Nova Scotia, Canada, 1986 | 21 | |
| CBNSC1 | Cat | – | Nova Scotia, Canada, 1986 | 21 | QpH1 |
| Dog ut Ad | Dog uterus | – | Nova Scotia, Canada, 1989 | 21 | |
| CB115 | Human heart valve | Chronic | Nova Scotia, Canada, 2003 | 21 | |
| Q212 | Human heart valve | Chronic | Nova Scotia, Canada, 1981 | 21 | |
| Scurry Q217 | Human liver biopsy | Hepatitis | Rocky Mountain, USA | 21 | |
| 48 | – | Slovakia, 1970 | 22 | QpH1 | |
| Irkutsk | Tick | – | Irkutsk, Russia1969 | 23 | QpH1 |
| Uzbekistan | Cow placenta | – | Uzbekistan, 1971 | 23 | QpH1 |
| 1894 | Liver and spleen of wild bird | – | Czechoslovakia, 1954 | 23 | QpH1 |
| Kazakhstan-6 | – | Kazakhstan, 1969 | 23 | QpH1 | |
| K-261-Louga | Cow milk | – | Leningrad, Russia, 1959 | 23 | QpH1 |
| Kazakhstan -5 | – | Kazakhstan, 1969 | 23 | QpH1 | |
| Russet mouse | Russet mouse viscera | – | Pskov, Russia | 23 | QpH1 |
| II/IA | – | Slovakia, 1972 | 23 | QpH1 | |
| IXO | – | Czech Republic, 1957 | 23 | QpH1 | |
| Mongolia-2 | – | Mongolia, 1985 | 23 | QpH1 | |
| CS-27 | – | Slovakia, 1972 | 23 | QpH1 | |
| Oufa-1 | Human blood | – | Oufa, Russia | 23 | QpH1 |
| Oufa-2 | Ewe placenta | Abortion | Oufa, Russia | 23 | QpH1 |
| Louga-3 | – | Leningrad, Russia, 1962 | 23 | QpH1 | |
| Louga-2 | – | Leningrag, Russia, 1959 | 23 | QpH1 | |
| Louga-1 | – | Leningrad, Russia, 1959 | 23 | QpH1 | |
| Louga rodent | – | Leningrad, Russia, 1958 | 23 | QpH1 | |
| Mongolia-1 | – | Mongolia, 1984 | 23 | QpH1 | |
| Vologda-2 | Human blood | – | Vologda, Russia, 1987 | 23 | QpH1 |
| 8931 F10 | Cow placenta | Abortion | Germany | 24 | QpH1 |
| Grita | - | – | Germany, 1940-1945 | 25 | QpH1 |
| M-44 | Vaccine | – | Russia | 25 | QpH1 |
| Kazakhstan-4 | Fly | – | Kazakhstan, 1965 | 25 | QpH1 |
| Termez | Human blood | – | Uzbekistan, 1952 | 26 | QpRS |
| Z2534 | Goat placenta | Abortion | Austria | 27 | QpH1 |
| Kazakhstan-1 | Ewe placenta | Abortion | Kazakhstan | 28 | QpRS |
| Kazakhstan-2 | Cow milk | – | Kazakhstan, 1962 | 28 | QpRS |
| Kazakhstan-3 | – | Kazakhstan, 1962 | 28 | QpRS | |
| Tcheredov | Human blood | – | Kazakhstan, 1965 | 28 | QpRS |
| Henzerling-r * | Human blood | – | Italy, 1945 / Slovakia, | 29 | QpH1 |
| Namibia | Goat | – | Namibia, 1991 | 30 | QpRS |
*Strain resistant to chlortetracycline obtained by passages in embryonated hen's eggs in presence of increasing doses of chlortetracycline.
| Primer | Nucleotide sequence 5´ → 3´ | Position in the gene | |
|---|---|---|---|
| djlA-1*† | CGGTGATGAACTGGATTGG | –5 – 15 | |
| djlA-2† | ATTGACCTGACGCGCTTGACG | 266 –247 | |
| djlA-3† | GGCAACGCAAGACCCCCGTG | 579 – 598 | |
| djlA-4*† | AACCATGCTTCGCACCTTAC | 810 –791 | |
| com-1*† | CGTGAAGAACCGTTTGACTG | 3 – 22 | |
| com-2† | TGAGGATTGCCTGCCACTGG | 284 – 265 | |
| com-3† | GCGCTGCTCAGTGTCGACGG | 490 – 509 | |
| com-4*† | CTTTTCTACCCGGTCGATTTC | 759 – 739 | |
| Primer | Nucleotide sequence 5´ → 3´ | Position in the plasmid | ORF |
| QpH11 | TGACAAATAGAATTTCTTCATTTTGATG | QpH1 (gb:AE016829) 15332 –15359 | Spacer between two hypothetical proteins |
| QpH12 | GCTTATTTTCTTCCTCGAATCTATGAAT | QpH1 (gb:AE016829) 168348 – 16375 | Spacer between two hypothetical proteins |
| QpRSO1 | CTCGTACCCAAAGACTATGAATATATCC | QpRS gb:Y15898) 14761 –14734 | Hypothetical protein |
| QpRS02 | CACATTGGGTATCGTACTGTCCCT | QpRS gb:Y15898) 14398 – 14321 | Hypothetical protein |
| QpDV1f | ATGAGAGAAGAGCAGCCGCT | QpRS (gb:Y15898) 9889 – 9908 | Hypothetical protein |
| QpDV1r | TCAATGATCCGATGTGCGTTT | QpH1 (gb:Y15898) 10634 –10614 | Hypothetical protein |
*Oligonucleotide primer used for PCR amplification. †Oligonucleotide primer used for sequencing.
| Cox 2 | Cox 5 | Cox 18 | Cox 20 | Cox 22 | Cox 37 | Cox 51 | Cox 56 | Cox 57 | Cox 61 | |
|---|---|---|---|---|---|---|---|---|---|---|
| ST1 (CB26) | AY492067 | AY495357 | AY502819 | AY502857 | AY502899 | AY502623 | AY502735 | AY502777 | AY502674 | AY512785 |
| ST2 (CB39) | AY574327 | AY574328 | AY574329 | AY574330 | AY574331 | AY574332 | AY574333 | AY574334 | AY574335 | AY574336 |
| ST3 (CB118) | AY574337 | AY574338 | AY574339 | AY574340 | AY574341 | AY574342 | AY574343 | AY574344 | AY574345 | AY574346 |
| ST4 (CB20) | AY492065 | AY495355 | AY502817 | AY502855 | AY502897 | AY502621 | AY502733 | AY502775 | AY502673 | AY512784 |
| ST5 (CB35) | AY494735 | AY495360 | AY502822 | AY502860 | AY502902 | AY502626 | AY502738 | AY502780 | AY502677 | AY512788 |
| ST6 (CB45) | AY494734 | AY502720 | AY502841 | AY502881 | AY502921 | AY502645 | AY502761 | AY502801 | AY502709 | AY512819 |
| ST7 (CB43) | AY574307 | AY574308 | AY574309 | AY574310 | AY574311 | AY574312 | AY574313 | AY574314 | AY574315 | AY574316 |
| ST8 (Priscilla) | AY596174 | AY502715 | AY502837 | AY502875 | AY502883 | AY502642 | AY502752 | AY502797 | AY502681 | AY596175 |
| ST9 (CB68) | AY494733 | AY502721 | AY502842 | AY502882 | AY502922 | AY502646 | AY502762 | AY502802 | AY502710 | AY512820 |
| ST10 (CB103) | AY492058 | AY495348 | AY502810 | AY502850 | AY502890 | AY502613 | AY502728 | AY502770 | AY502688 | AY512805 |
| ST11 (CB13) | AY575668 | AY575669 | AY575670 | AY575671 | AY575672 | AY575673 | AY575674 | AY575675 | AY575676 | AY575677 |
| ST12 (CB33) | AY492069 | AY495359 | AY502821 | AY502859 | AY502901 | AY502625 | AY502737 | AY502779 | AY502676 | AY512787 |
| ST13 (CB2) | AY575653 | AY575654 | AY575655 | AY575656 | AY575657 | AY575658 | AY575659 | AY575660 | AY575661 | AY575662 |
| ST14 (CB85) | AY575643 | AY575644 | AY575645 | AY575646 | AY575647 | AY575648 | AY575649 | AY575650 | AY575651 | AY575652 |
| ST15 (CB102) | AY492057 | AY495347 | AY502809 | AY502849 | AY502889 | AY502612 | AY502755 | AY502769 | AY502687 | AY512794 |
| ST16 (Ohio) | AY494725 | AY502712 | AY502834 | AY502872 | AY502916 | AY502640 | AY502748 | AY502794 | AY502707 | AY512816 |
| ST17 (CB77) | AY574325 | AY574326 | AY574317 | AY574318 | AY574319 | AY574320 | AY574321 | AY574322 | AY574323 | AY574324 |
| ST18 (Henzerling) | AY494723 | AY495369 | AY502832 | AY502870 | AY502914 | AY502638 | AY502746 | AY502792 | AY502701 | AY512814 |
| ST19 (CB119) | AY575633 | AY575634 | AY575635 | AY575636 | AY575637 | AY575638 | AY575639 | AY575640 | AY575641 | AY575642 |
| ST20 (CB88) | AY492072 | AY502719 | AY502825 | AY502863 | AY502905 | AY502629 | AY502759 | AY502783 | AY502696 | AY512798 |
| ST21 (Q212) | AY494729 | AY502716 | AY502838 | AY502876 | AY502918 | AY502643 | AY502753 | AY502798 | AY502682 | AY512793 |
| ST22 (48) | AY864229 | AY864230 | AY864231 | AY864232 | AY864233 | AY864234 | AY864235 | AY864236 | AY864237 | AY864238 |
| ST23 (Irkutsk) | AY864239 | AY864240 | AY864241 | AY864242 | AY864243 | AY864244 | AY864245 | AY864246 | AY864247 | AY864248 |
| ST24 (8931 F10) | AY864199 | AY864200 | AY864201 | AY864202 | AY864203 | AY864204 | AY864205 | AY864206 | AY864207 | AY864208 |
| ST25 (Grita) | AY864209 | AY864210 | AY864211 | AY864212 | AY864213 | AY864214 | AY864215 | AY864216 | AY864217 | AY864218 |
| ST26 (Termez) | AY864219 | AY864220 | AY864221 | AY864222 | AY864223 | AY864224 | AY864225 | AY864226 | AY864227 | AY864228 |
| ST27 (Z2534) | AY864249 | AY864250 | AY864251 | AY864252 | AY864253 | AY864254 | AY864255 | AY864256 | AY864257 | AY864258 |
| ST28 (Kazakhstan-2) | AY864259 | AY864260 | AY864261 | AY864262 | AY864263 | AY864264 | AY864265 | AY864266 | AY864267 | AY864268 |
| ST29 (Henzerling-r) | AY864269 | AY864270 | AY864271 | AY864272 | AY864273 | AY864274 | AY864275 | AY864276 | AY864277 | AY864278 |
| ST30 (Namibia) | AY864279 | AY864280 | AY864281 | AY864282 | AY864283 | AY864284 | AY864285 | AY864286 | AY864287 | AY864288 |
Dr. Glazunova obtained her doctorate in life science at the Russian Medical State University (Moscow) and Irkutsk State University. She is currently a postdoctoral researcher at the Medical Faculty of Marseille. Her specialty is the molecular identification of bacteria.